QPCR

From EchinoWiki
Jump to: navigation, search

The Davidson laboratory at Caltech generated a panel of quantitative PCR primers useful for measuring mRNA abundance of genes involved in early development, particularly those in the endomesoderm gene regulatory network. Below is the table of primer sequences.

Note that the gene names listed in the table have been updated according to nomenclature guidelines and may have changed on the gene pages in Echinobase, however, they are listed as synonyms and the gene pages can be found by searching for the name listed in the table.


qPCR Primer Table

GENE Full Name Contributor Primer seq (Forward) Primer seq (Reverse) Primer Length Tm Product size Comments from Q-PCR Source for seq. info
18S 18 S ribosomal RNA AR CAGGGTTCGATTCCGTAGAG CCTCCAGTGGATCCTCGTTA 20/20 59.7/60.1 185 bp works well; clean disassociation curve Turbeville et al 1994; NCBI: L28055
Alx PO CAGTGCAGCTTTACGTGGAC TTAAGTCTCGGCACGACAAA
Apo L Apolipophorin JR AGAAGAGCATCGTGCAATGA CAGCCATGGTGTTAGCAATG 20/20 59.55/60.13 154 works well; clean disassociation curve Cdna
APOBEC cytidine deaminase JR ACCCAGTTTCACCCTCCTCT AGGCACTCAGCTGCAAAGTT 20/20 59.97/60.20 162 ok Bra screen
Blimp1a SpKrox JS GACCGAGGTCGATTACCAGA CCGCGTACCTTTTGGTATGT 20/20 175 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Blimp1b Spkrox early form JS TCGCTATGCGGGATCTCTAC GGGGTCCTTGACCTCGTAA 20/19 56.1/56.3 206 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
BMP2/4 Ligand JN CCAGCAAGGTCGAAGAACTC CTCTACCCGACGACGATGAT 20/20 ~60/~60 126bp works well; clean disassociation curve
BRA Brachyury CL ACACATCGACCCATCATCAA CATGGTGTCGTATCTTGGAAAG 20/22 59.77/59.49 139 works well; clean disassociation curve
Brn1-2-4 (UI) Brn1-2-4 (novel POU domain transcription factor) CY GTCGCATTAAGCTCGGCTAC CAGCGGCTTCAGTTTACACA
CAPK SMC JR ccaagtacgcaggaggaaga gagagcatcggctattgtca 20/20 60.39/58.98 100bp OK Endoderm/Ectoderm diff. Scr. Larval Cdna
CAT CAT REPORTER TCCGGCCTTTATTCACATTC CGGTGTAACAAGGGTGAACA 20/20 53.9/55.1
Cyclophillin PMCspecific GA CCAAAGTGATGGAGGTGCTT ACAATCGTGTATGGGCAAAT 20/20 60.1/57.8 161 bp works well, clean dissociation curve cDNA from 40h lyb
CyIIIa PO ACGCTGCAGGATTTGTAATG TGCCAATGACAATCCCTATG 20/20 58.80/59.36 146BP not tested, ordered
cyIIIa - UTR cyIIIa mRNA, against 3' UTR TB GAAGAACAAAAATAAAACGCATCTG ATTGTTTGTATTGCATTCTCCAATC 25/25 60/60 60 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
cyIIIa int1 cyIIIa intron probe TB TGAACAAAACTGTGAAATGTGAAA GGGCAGGGATAAAGTACCATC 24/21 60/60 108 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Dec Decorin CC TTTATCTAGTTACACTTTTGCTGGTGA ATAGATTGAGATTATCAAAGCCTCCT 27/26 59.7/59.1 300bp works well, clean dissociation curve cDNA from 20 hrs arrayed lib.
Dec II Decorin CC GTCCAGGTGGAACACCAGAT TGCTCCTAATGGTACGTTGACA 20/22 59.82/60.55 158bp works well, clean dissociation curve cDNA from 20 hrs arrayed lib.
DELTA PO ACGGAGCTACATGCCTGAAC TCACAATGGACCGAATCAGA 20/20 60.29/60.05 151bp works well, clean dissociation curve H.Sweet cDNA
Dop T Dopamine tautomerase JR CGAGTTCGCGTACAGCATAG GAATCCTTCGGGAAACTGCT 20/20 59.66/60.58 143 works well; clean disassociation curve Cdna
Dri PMCs 15-20h; Oral Ectod after25h GA GGTTTCCCTAGGCAAGGAAC GACAAGATGCTGCTGTTGGA 20/20 58.9/59.4 147bp works well, clean dissociation curve cDNA from 40harrayed lyb
E(spl)-1 Enhancer of split-1 CC AGTCACAGTTCCCCAGCAAC GTGACTGTGGTGGTGTCAGG 20/20 60.16/60.05 200 works well, clean dissociation curve partial seq from Posakony's lab
ECM3 ECM protein (see Ettensohn) AR AGGGCAGTGATGTTGCCTAC GTTTGCAGCAGGGTCGTATT 20/20 60.1/60.1 161 bp works well; clean disassociation curve cDNA clone from 12 hr arrayed lib.
Ef1 Elongation factor 1a CA-M CTTGGAAAGGGATCGTTCAA GCCTGTGAGGTTCCAGTGAT OK Endoderm/Ectoderm diff. Scr. Larval Cdna
ENDO 16 Calcium Binding Protein CL GACCGAACGCCGATATAAGA GCCATCGTCCCTTTAGTTCA 20/20 60.06/60.07 198bp works well; clean disassociation curve NCBI: L34680
Erg Mesoderm ets factor QT AACGAGAGCCACATCTGGAG TTTCGCTACGCTACAATCCA 150bp
EVE Even Skipped AR CACAGACCCTGGACTTTCGT GACAAACGGTCATCCCACTT 20/20 60.2/59.8 175 bp works well; clean disassociation curve cDNA clone from 12/15hr arrayed lib.
Ferr Ferritin CA-M GCCTCGAGGAAGTCAGTCAT ACCAACGTGGAGGTAGCATC OK Endoderm/Ectoderm diff. Scr. Larval Cdna
FGF Ligand JN CTCTTTGCCACCCTCATCAT CCCTCGACTTGATGCTTTTC 20/20 ~60/~60 172bp works well; clean disassociation curve
Ficolin fibrinogen-domain protein JR GATGGACAAAGAGGGCTACG TGAACCAGTCCGTCACTTCA 20/20 59.69/60.29 197 CDNA
Fkh1/FoxB SpFkh1 PO AAGCCATCCACAACCAAATC CATATCCGTCGAACGAGTCA 20/20 59.80/59.67 147bp works well, clean dissociation curve David,E.S. et Al (1999) NCBI:AF149706
FMO Flavin-containing monooxygenase CC GTCGGTGGACAATCACCTCT ACGAGGACATTCTTGCCATT 20/20 59.97/59.56 199 works well, clean dissociation curve cDNA from 20 hrs arrayed lib.
FoxA (=HNF3beta) TF PO CCAACCGACTCCGTATCATC CGTAGCTGCTCATGCTGTGT 20/20 60.34/60.23 160bp works well, clean dissociation curve Coding from BAC clone
FoxN2/3 PMC TF TTCATGTCGATAGAGGACTGC TTCGGAAGCACTTGTTGAGA
FoxY Forkead class gene FoxY AR TGCACTGCACTGACTCTGC CTTTCCATTCCGTGGTGAAG 19/20 works well; clean disassociation curve cDNA clone from 12 hr arrayed lib.
GAPDH Phosphate DeHydrogenase internal standard Garry Wessel AGGCTTCTTCAGACGGACAG TGCTAAGGCTGTTGGAAAGG 20/20 59.6/90.38 120 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
GATA c TF PO CAGGGACATCATGTGCAAAC CCGTGTTTGAATGCCTTCTT 20/20 59.97/60.11 155bp works well, clean dissociation curve cDNA clone from 20hr arrayed lib.
GATA e Gata 4/5/6 factor CL ATGCATGCGGTCTCTACCA CGCCACAGTGTTGTAGTGCT 19/20 works well; clean disassociation curve NCBI: AF077675
GATA e (2) TF PO CTGGCTCAAGACGAGAAGGA CCTCTTCCGAGTCTGAATGC 20/20 60.67/59.95 176bp works well, clean dissociation curve cDNA clone from 20hr arrayed lib.
GCM Glial Cells Missing AR CGACTGATAACCACGCTCAA TTAACGACGTCGGTCGATTC 20/20 59.9/61.0 178 bp works well; clean disassociation curve cDNA clone from 12 hr arrayed lib.
Gelsolin gelsolin-domain protein JR CTCCATCGACGAGAGGAGAA CCTTCTGCTACGACCGAAAC 20/20
GFP PO AGGGCTATGTGCAGGAGAGA CTTGTGGCCGAGAATGTTTC 20/20 59.97/60.64 152bp works well, clean dissociation curve Cathy seq on EpGFP
Hedghog Ligand PO ggcttcgattgggtcaacta GTTGACCACGGCTACCTCAT 20/20 ~60/~60 ~150bp works well; clean disassociation curve
HES Hairy JR TCTCAGGATTGGCAGCAAGT CGTTAATCCTCGCTCGTCTT 20/20 60.94/59.48 175 Cdna
HesC Repressor of micromeres ccagaacagggcgaatctaa CGAAGACGGGTTTCAATGTC 20/20 ~60/~60
Hex (TF 263) PMC and SMC TF MH TTCTTGTGGAACCCGTTCAT CGGGGAGAGGTATTTCTGGT
Hmx SpHmx CL TCGTCGTTTGAAGGTTGAAGT TGATAGACGCATCTTGCTCG 21/20 59.77/60.12 152 works well; clean disassociation curve NCBI: D85079
HNF3beta HNF3 beta (same gene as FOXa) AR CATTGATCGTATCCGTGCTG TTGCCACCGTTGTTGATTT 20/19 60.1/60.0 190 bp works well; clean disassociation curve cDNA clone from 15 hr arrayed lib.
HNF-6 Hepatocyte Nuclear Factor 6 OO TGCAGCTTCTCTGCATACCA ACTCCAACATGCCTCCAAAC 20/20 51.8/51.8 152bp works well, clean dissociation curve cDNA clone from 7/20/40hr arrayed lib.
Hox11/13B TF Hox cluster PO CACAGGCTCTCGACCTAACC GGTGGATGAGGTGGTAGATGA 20/21 59.87/59.79 155bp works well, clean dissociation curve Dobias et al(1998) NCBI:AF042652
Hsp70 Heat sock protein CA-M CACTTGGGTGGTGAGGACTT TACCCTCAAACAGGGAATCG OK Endoderm/Ectoderm diff. Scr. Larval Cdna
ISP1 nontrans poly A mRNA AR TGTGTTTCATTCCGTGGCTAT GCCAACCCTTCTGATCAACT 21/19 60.4/59.1 180 bp works well; clean disassociation curve Calzone et al 1988; NCBI: Y00216
KAKAPO actin binding JR GTGGCATTTATGAGCGGTCT CGGCCCAGTACTTCAAGGAGA 20/20 60.10/59.28 177 OK Bra screen
Krl The original information has been deleted by someone, unknown reason. TM (originally contributed by CBL) CACGAACTCTTCGCAATCAA CCAAGGGACAGGAGTGAAGA
Lefty Lefty, Nodal inhibitor JN CGTAGTCGCCACATCAGAGA CAGATACATCATGGGCAACG 20/20 ~60/~60 132bp works well; clean disassociation curve
LIM Lim-HD PO GTATCCGATCCGTTGACGAC TAGCCTTGCATTCACAGCAC 20/20 60.35/60.02 153bp works well, clean dissociation curve cDNA clone from 15hr arrayed lib.
Lys Lysosomal associated protein CA-M TACCCGACAACCACTGTGTC GCTCCCTCTCTGCGAAATAA OK Endoderm/Ectoderm diff. Scr. Larval Cdna
Msp130 PMCspecific GA agagcaacgctcattctggt ctccgaattgcattttgtca 20/20 60/59.7 149bp seems ok: ask me for dissociation peak
Nk1 Nkx1 homeobox TF JR GACCATGCATGTGCGTAAAC TCTGTGACTGCCACTCATCC 20/20 60.00/59.83 175 works well; clean disassociation curve Cdna
NKX 2.1 Apical plate from 24h on GA CGTGAGAGCTTCCCTACCTG GAAGCTCCCTAGCTCGATGA 20/20 59.5/60.0 201bp works well, clean dissociation curve Peterson et al., umpublished data
Nodal nodal, OE activator JN GACAACCCAAGCAACCACG CGCACTCCTGTACGATCATG 19/20 ~60/~60 178bp works well with Sp, Lv, and Pl Nodal; clean disassociation curve
Not SpNot CL GAGCGACTTGAGCAGGAGTT GGACCTGCTGTTTCTCGAAG 20/20 58.75/59.99 159 works well; clean disassociation curve NCBI: AF109903
Notch CC ACGGAGCCAAGCCTAAGAA TCGTCACAGGCAACGAATAA 19/20 59.9/60.2 207 works well, clean dissociation curve
nrl neuralized-like Zn fing; Ubq Ligase JR ATAGGTGCCCTGCACATAGG ATCCAGCTTCCGAGGGTAAC 20/20 59.98/60.46 148 works well; clean disassociation curve Cdna
OrCT Endomeso diff gene JR GAC TTC AGA CGC GTT GGT CT TTA TCA CTG TCG GGG AGT TTG
Otx-alpha new SpOtx-alpha (exon6) CL/CY CCTTACCAGCACCTGATCG CTGGTCCTGCTGAACAAGGT 19/20 57.0/57.2 192 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Otx-beta1 This primer recognize both SpOtx-beta1and beta2 (exon 3 and 5) CL/CY GTTTAGGAACGTCGCTGGAA TGAAGGTGGTGGTGATGTTG 20/20 55.15/55.15 487/187 The efficiency of this primer has been confirmed by CY. The previous Otx-beta primer has been removed from this data base because it does not work well.
Otx-beta2 Recognize exclusively SpOtx-beta1 (exon 4) CL/CY TGAATAACAGCCCTAGAAGAGCA CTGCTCTACCGTCACCGATT 23/20 55.74/56.23 130 The efficiency of this primer has been confirmed by CY. The previous Otx-beta primer has been removed from this data base because it does not work well.
Otx-beta3 This primer recognize SpOtx-beta3 (exon 1 and 2) CL/CY CCACTCCACCGCTTCTACAC CTTCAAGGTGCCGATAATTGA 20/21 59.25/53.42 150 The efficiency of this primer has been confirmed by CY. The previous Otx-beta primer has been removed from this data base because it does not work well.
Otx-beta4 This primer recognize SpOtx-beta1, beta2 and beta3 (exon 5) CY TGGATCATTCTGCCTTGACA ACATAGCGGGATGCATGAG 20/19 54/54.9 189 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Pitx2 TF MH ACATTTCACCAGCCAGCAAC TCAAGTTACACCACGCACAGA 104
PKS polyketide synthase JR ATCGTTGGATCCTCAACAGC GACACACTGTGCGCAATACC 20/20 60.08/60.19 195 works well; clean disassociation curve Cdna
Pm27 PMCspecific GA cgaaagtggtctgctgatga ctcgctctctctttccaacg 20/20 59.98/60.27 149bp works well, clean dissociation curve
Pmar1 Sp Hbox 12 Homeodomain TF PO GCGTTCAACGACAACCAGTA GGTTGATGAGCAGAGCTTGA 20/20 59.76/59.12 152bp works well, clean dissociation curve cDNA clone from 9.5hr phage lib.
Prox1 SMC TF AGGTACCGGAGGGCTTCTT ATGGTCTTCTTCCAGGATGG
RFP RFP (I got RFP clone from Mr. Damle) JN ATGAGGCTGAAGCTGAAGGA TGGTGTAGTCCTCGTTGTGG 20/20 ~60/~60 142bp works well; clean disassociation curve
S403 CC CTGCGGTGAGAGCAAGTTTA GAGAGCGTTGCCTGAACAAC 20/20 59.2/60.99 199bp works well, clean dissociation curve cDNA from 20 hrs arrayed lib.
Six1/2 Aboral SMC TF SM TGAAACACCGTCAAAACAAGG TGCTCTGGATGAAGATGAAGG
SM30 Spicule Matrix protein OO GTTCTCCGGTAGGCAAACA ACATTTTGGGGCAAATGAAA 19/20 59.4/59.9 196bp works well, clean dissociation curve Akasaka,K. ET AL.,1994.NCBI U05962
SM50-LC SM50 LC tagcctttgctacgggtcaa ctgaggcgacgaaactgaa 20/19 60.4/60.16
Snail EMT TF expressed in SMC SM AAGGAGTACTCGACGTTCGG TCCTGATGTGCATTTTGAGG 136bp
Sox B1 SpSox B1 CL ATTCTGTGAACGTCATGGCA TTGTCCTCTTGACCACACCA 20/20 60.12/60.13 184 bad dissossiation curve NCBI: AF157389
Sox E Sp SoxE MH CGGGAAGAGAAAACCTCACA TTTTCCCAGGGTCTTGCTC 130bp
SoxC Wave TF MH CATGGTTTGGTCACAAATCG TACGGAGATTTCGCCACTTC
Sp cbf-a CCAAT-binding factor, A (Ubq expression) TB ACCCATCGCTAATGTTGCTC CACTGGCTTCGCTTGTGATA 20/20 60/60 131 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Sp cbf-b CCAAT-binding factor, B (Ubq expresion) TB GGATTCCCAAGGAGAGAAGG ATAGAGGGCGAAGGGATCAT 20/20 60/60 130 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Sp cbf-c CCAAT-binding factor, C (Ubq expression) TB TCCTCTTATTCTCTTCTGTATGTAGCC ATAAGTGCTGAAGCCCCAGT 27/20 60/60 100 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Sp gcf-1 GCF1, general activator TB ACCAGACCTTCTCCCACCTT TCTCTTGCGGTTGTTCTCCT 20/20 60/60 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Sp myb myb (cyIIIa repressor) TB AACCATTCACAAGCCACTCC TGGTCCTCCTGCCTTCTCTA 20/20 60/60 147 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Sp oct-1 oct-1, cyIIIa activator TB CACAGGGTGATGTTGGTCTG GGAGAGGTTTGAGCTTGCAC 20/20 60/60 123 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Sp P3A2 P3A2, OE repressor of cyIIIa TB AGCATCATGGAAGGGATGAC GTGTACCACAGCATGGGATG 20/20 60/60 104 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Sp runt runt (cyIIIa activator, ubiq) TB CGGTACGGAGGAACAACCTA AGGGCTCTCTGTCTTCACCA 20/20 60/60 149 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Sp tef-1 TEF-1/scalloped, cyIIIa activator TB GGCCACTGCCTTACAAGAAC AGGGTCATGAGATGGTCCTG 20/20 60/60 146 The efficiency of this primer has been confirmed by CY. The previous Otx-alpha primer has been removed from this data base because it does not work well.
Sp tondu tondu/vestigial, TEF-1 co-factor TB ACTCCGGTGATTTGGACAAG CAGTGAGCGGCTAAAATGTTC 20.21 60/60 50 The efficiency of this primer has been confirmed by CY.
The previous Otx-alpha primer has been removed from this data base because it does not work well.
SpDlx Aboral Ectoderm TF EL CCAGCTTACAACTCCAACAGC TTACCTGAGTTTGAGTGAGTCCA
SPEC 1 aboral ectoderm GA GCGCATGCTCAGATTGTATC CAAGGAGTGGTAAGGGTGGA 20/20 58.6/59.0 164 bp works well, clean dissociation curve Hardin,S.H.,1985 NCBI X03287
Spec2a SpSpec2a PYL GGACGGTAAAATCTGCCTTG AGACGATTATGTCACCCTCTCC The efficiency of this primer has been confirmed by PYL.
SpElk Ets TF Inna ATCATGGTCGCTAGTCCTCTCCT TGACAAGAGAACAGTCGGTGTGA
SpEts TF PO GCACTGGTCCATCAAGGAGT GATGTGCTCCCAGAGGATGT 20/20 60.12/60.08 145bb works well, clean dissociation curve Rao and Childs(1993) NCBI:L19541
SpEts4 TF Ets4 PO CTCCAGCCCAACTCCTACAG GATGGAGCGAGAGAGCTTGT 20/20 60 works well, checked by Paola
SpGsc Homeodomain TF PO GCGACACGCTCCCTATCTAC CGATGTCGCCTCTTTCTCTT 20/20 59.87-59.57 147bp works well, clean dissociation curve Angerer(2001)-NCBI: AF315231
SpIrxA Aboral Ectoderm TF EL TATGGAATGGACCTGAACGG TATGATCTTTTCGCCCTTGG
SpLox A gene that is expresed in the endoderm at 45 h Ina Arnone GTGCGACGGACTCCCTATAA TTCAGACGCCATGGTGTAAA 20/20 56.2/54.4 works well, clean dissociation curve
SpMSP130like PMC differentiation gene JR TTC TTG GTC GCC TGG ATT AC ACC TTG GCA TCG CAT AGA AG
SpNK2.2 Aboral Ectoderm TF EL ACACTTGGCGAGCATTATCC CGGAGAAGGTAACGGATTCA
SpTbx2/3 Aboral Ectoderm TF EL ACTGCCGGTACAAGTTCCAC GACACATTTCTGCATCCATTG
SpZ12-1 TF PO AGTCGTCCAGCCATGTCTTT AAGCACACCTCGCACCTATC 20/20 59.73/60.29 151bp works well, clean dissociation curve Wang D. et Al (1995) NCBI:U19831
Su(H) Suppressor of hairless CC GCTCCATCGTTGATGATCTCT GGACGCTGATGATCCAGTCT 21/20 59.26/60.23 156 works well, clean dissociation curve partial seq from Posakony's lab
SuTx sulfotransferase CC AATTCATGCCAGAGCCATTG CCGAGAACTCGACCTTCAAC 20/20 61/59.84 204 works well, clean dissociation curve cDNA from 20 hrs arrayed lib.
TBR T-brain JR GAAACATTCGCCTTCCTTGT GAAGGCGTCGGTTTACCTCT 20/20 59.17/60.63 98 primers reversed, and 3' primer bridges exon1 and exon2, making this pair unsuitable for genomic DNA quantitation Cdna
Tel Maternal + Zygotic mesoderm TF QT TGTTAGCTTCTGCCCCTGTT CGACGAGAGAGGGTCTTCAG 162 bp
Tgif (ark 43) PMC and Endoderm TF MH GCTCTACCTATCTCGCTTGGC TGGTGAACTTGTCAGGGTCT
UBQ Ubiquitin CL CACAGGCAAGACCATCACAC GAGAGAGTGCGACCATCCTC 20/20 60.16/59.95 147bp works well; clean disassociation curve
VegFR VegF Receptor JR AGGGCAGGTCAACAGTTCAG GGCAACCAATTTGACATCCT
Wnt 5a Wnt 5a PYL TGCTGTGGAAGAGGCTACAA TTCTGCACTTCCGACACTTG 20/20 works well, clean dissociation curve
WNT 8 (2) PO TGTCGTTCATTCAAGCCATC TATCACTCGCCATTCGTTCA 20/20 59.65/60.22 183bp works well, clean dissociation curve