Nanostring

From EchinoWiki
Jump to: navigation, search

The Nanostring nCounter identifies and counts RNA molecules based on a fluorescent barcode attached to a sequence specific hybridization (Geiss, G. K. et al, 2008). The Barsi et al., 2013 Nanostring probe set contains codes for 341 genes covering the majority of active, and spatially restricted regulatory genes in the Strongylocentrotus purpuratus embryo up to the pluteus larva stage (72 h post-fertilization). A description of the use of our previous code set was published by (Materna et al., 2010). They showed that Nanostring nCounter yields measurements with high fidelity over 5 orders of magnitude at levels down to a few transcripts per embryo.

Note that the gene names listed in the table have been updated according to nomenclature guidelines and may have changed on the gene pages in Echinobase, however, they are listed as synonyms and the gene pages can be found by searching for the name listed in the table.


BARSI 2013 NANOSTRING CODESET



GeneName Accession Comments TargetSeq
Ac/Sc GLEAN3_28148.1 ENDOGENOUS GTCGCACGCCGTAACGAACGGGAGCGAAACCGCGTCAAACTCGTCAACCATGGATTCGCCAATTTACGCCAGCAGCTCCCTAACGGCGCCAATAATAAGA
Af9 WHL22_754828_0.1 ENDOGENOUS CAGAGGGAAGCTGCATAGAGCACTTTGTCGACAGAGTCGTATTCCAACTTCATGAGAGCTTTCCAAAGCCTAAGAGAGTTGTAAAGGACCCACCTTTTGA
Ahr_1/Ahr WHL22_676940_0.1 ENDOGENOUS AGCTACTTCCAAGATACACGTGACAAAGATCTCTTCCAGTCAGGCTCCTCCAACGGCCTAGCTCGCTTCCTTACTTGCGCCTCCTCCTCCTCTTCAAAGT
Alx1_1/Alx1 NM_214644.1 ENDOGENOUS AAGAAGAGGAGAAATAGGACGACGTTCACCAGCTATCAACTTGAGGAGATGGAGAAGGTATTTCAAAGAACGCACTATCCCGATGTGTACTGCAGAGAAC
Alx4 WHL22_731149_0.1 ENDOGENOUS CTAATGCCAAGAGGAAAAAGAGGAGGAACAGGACGACGTTTACTAGTTTCCAACTCGAGGAGATGGAGAAAGTCTTTCAAAAGACACATTACCCGGACGT
Ap2 WHL22_151633_4.1 ENDOGENOUS ACGGGTCTTCATCCTATGGACGATGGCTCGATACCCACGGATGAACGTTTCTCAAGGTTAGCCCAGGGAGACTATTTCACGAATATGAGGGCGCTTTTCC
Ap4/Tcfap4L WHL22_28828_0.1 ENDOGENOUS ATGGCATTCTATGCATTGAAATCGGAGAAAGATACAATTGGCGGATCCTTGCGAGTTCCCAGCGATATGATAAGTCCGAGGGGAAGTCCGTCTCCACCAG
Arnt/ArntL GLEAN3_00129.1 ENDOGENOUS CAAGCCAAAAGTCGAGACTGGGTGTGGCTTCGAACCAGCTGCTTCAGCTTTCAGAATCCTTACACCGATGAAGTGGAGTACATCGTCTGCACCAATACAG
Arxl WHL22_134213_0.1 ENDOGENOUS GCATGCGAGGATTCACCATATTCGGAGCTTACATACGGAGGTGATTTGGACGAGACTTTTGCGAGAAGGAAGCAGCGAAGAAACAGAACCACATTTACTG
Ash1 WHL22_755846_0.1 ENDOGENOUS CTACAGCTTCAGTTTGACCATAGTCATGCTGCCCATGGAGATGAACCTGTCCAGGTGTCCCTTGCCGATGTTGATGCGGTCGTCAATGCTGATGTCGGTA
Ash2 WHL22_96450_4.1 ENDOGENOUS GAGGGCGACACGTTAGGATTCTTCATTCAGCTTCCAGAGAAGACAGAGAAGGATCCAATCATCCCTCCGACCTACAAGGACAGAGCCCTGATTAAATTTA
Ash3L WHL22_523564_0.1 ENDOGENOUS CCCGTACCGAACTACCTCGACCCTCGCTACGCTAGCTCCTTCATCAGCCACTACGGGCATAGCTACGTCCCACTCCCGAACCCATTCGGATTCTACGATC
Atbf1 GLEAN3_17348.1 ENDOGENOUS CGGCGATCAGGGAGGACAAGGTTTACAGACTACCAGATTAAAGTTCTACAGGAGTTTTTCGAAAGCAATGCCTACCCTAAAGATGATGACCTCGACCACC
Atf2 GLEAN3_26905.1 ENDOGENOUS GATATATGTTCATAAGAGGCAGCGTGTTTCGGAGGAGGACGATAACGAGAATAAACGACAAAAGTTCCTGGAGAGGAATCGAGCTGCTGCTAGTCGGTGT
Atf6b WHL22_176487_0.1 ENDOGENOUS GGGGATCCTGGGTTCTACAATGGAAATCATGTACGAGATTTATCAGAAGATTTAAATGTTGCTGAAGAAATGGCCTTTAATTCTGGACTGGATGAAGAGG
Atl7L WHL22_523571_0.1 ENDOGENOUS GGCGGAAGAAATGGACCTGAGTCGGGTCAGTTTGACAATTCCCAAGAATTCAACCACCAGGGGAGTGCTAATTTGCAGTCTGAAATATCCCAAAATAGAA
Ato WHL22_459901_0.1 ENDOGENOUS GCGAGATGGTGAAAATGGAAGTGGATCTGGTAGAGATTAAATCCGAAATCATAGACCACGGTGATAGCGATAGTCATGGGAAAGATCCGGAAGACCATTT
Awh WHL22_9369_0.1 ENDOGENOUS GCGCTGGGTGTGGAAAGGCAATTATTGATCGTTACTTGTTGAGGATAGGGCGTGGTCTGAGCTGGCACTCATCCTGTCTTCGATGCCTTGAGTGTGATGA
Barh1 WHL22_299123_0.1 ENDOGENOUS TCGCGAATTCGACAGACGATCAGCATTCCACTTCAGGCACTCTGATCTCTCGTTACAGCGAGCTGAAAAAGACAATAAGGACATTGATGACGATGTCGAT
Barx/Barx_1 WHL22_133111_0.1 ENDOGENOUS TTTGCATTCGTCATCGCGACCTTCGTCACCACCGCAACAGAGATGTTTGCCATCGCCGGAACTTCGGCGGAAAAGTTCTCCGGATAACGCTATCAGTCCA
Bbx WHL22_356734_3.1 ENDOGENOUS CCAAAGAGCAGTGACTTCAAGAGCCCTTTGAAGAAGTTGAAGGAGAATCTGTTAGGGAAGCACTCTTCATCCTCCTCCTCATCGACGACTATCACTAATG
Birc6/Birc6_1 WHL22_609255_0.1 ENDOGENOUS CTCCAGTGACCTCTTCTCGACCATTCTGCTCACCAGGGACAAGTGTATTCCTGTTGTCCAGGGGCTAGTAAGACTTTTGCTGGCTATGGATTTCACCTGC
Blimp1 WHL22_5073_1.1 ENDOGENOUS AAGATGCCAACAAGAAATACTTTTGGAGGATTTACAATGGCCAGAAGTTCGTCCACTACATTGACGGTTTCAACAAGAAGCGAAGCAACTGGATGCAGTA
Bmal WHL22_117405_0.1 ENDOGENOUS GTGCACTGTAATGGGTATACCTAGCGTCTCAACGAACCTGTCTGGGTTTGGTTTGTTCATGGGTGAACACGTAGCTGATCCTACCTCCTATGGCATCTAC
Bra_1/Bra WHL22_600041_0.1 ENDOGENOUS AAAAGCTTTCCTGGATATCAAAGACAATAGAAACGACGGACATGATCTCTTCGATGATGTGCACGATTTCCAGGGTTCAAAGTATCCACAATTTGGAGGC
Brn1-2-4 XM_777816.2 ENDOGENOUS GGGTGTTCTGGGACCAGGTGGTGGTCAGTTACCTAGTCATAATGGTTCCGAAACGGTGATCGAAGACGATGCACCGTCATCGGATGATCTCGAGCAGTTT
BsxL WHL22_497248_1.1 ENDOGENOUS CGTTGAAATAACCAAGAAGACCTGCAGATCGCCATCGCCTCCATCTCAAGATAGGAAGAAATTGAAGAGGAATTTCTCAGATAAGTCTGATGGGGAGGAG
Cdxl/Cdx XM_001182111.1 ENDOGENOUS ACAGCATTCATCAAGCCCTCATCATACCACAGTCGACACCAAACCCAAACTCCCGATCATAACAACGATGACCACGGTCTCCGGCGATGTCATCAAGACG
Cebpa GLEAN3_01657.1 ENDOGENOUS TCTATTGATATTGACGCGTACTTAGCTTTAGGGAGGGCTGAGGTACAGCAGAACAATCACGTTGATAATACTGGTGACGGAATTCTCCGACAGCTAGAAC
Cebpg WHL22_744360_0.1 ENDOGENOUS CACCACTTTTGGGCTGTTCAATGCCAACCCAAGGTTGGGGTCCAGTTCTCCTAACCCAGCTCTGTCGCGGCGCATTGTCCTCAAAACTGAATCTCTCACT
Chx10 WHL22_249523_0.1 ENDOGENOUS CTGGTCATCAACGATCATCGTTCGCTATCCATGAACTCCTGGGGCTTGGTCGTCAAGAGCAGCAGAAATCTCGGGAATTCATCCCATCACGACCGCTCAT
Cic WHL22_183787_0.1 ENDOGENOUS TAGCTCCAAACAGGCCATCGTCTACTCCGGCCAACTTTAACCAATCATTGCCAACATCTGTCATCGTTGCAAGAACGACGGATATCCAAAGCAATGTCCA
Clock WHL22_335679_0.1 ENDOGENOUS ATGAACTACGGAAAGAGGTCTTCCTTACCGAAGACCAACAGAAAAATATGTGATATGTATGATGATGGTGAAGATAGTAAAGATACCACAAAGAGGAAAT
Couptf1 WHL22_647845_1.1 ENDOGENOUS GTTGCAAGAGTTTCTTCAAAAGGAGCGTCCGGCGTAACCTCACCTACTCGTGTCGTGCTAATCGGAATTGTCCTATTGATCAACACCACCGGAATCAATG
Cp2 WHL22_553348_0.1 ENDOGENOUS TGGACTTGCTGAAGATTTTGCATCGAATTTGTCGGGTTTGGGAACTGAGCTTGGCACGGGAGCCTACAACATGAGTGAGGTGTTAGCTTTGCCTATGTTC
Creb/ WHL22_278056_0.1 ENDOGENOUS CCCTCAATCAAGTGGTTCACGTCCAGTCTGTCATTCAAACTAACAACCAGCACTCCGTCATTCAGGCTACTCCTGTAGTTCAAGTTCAGCAGTTGGATGA
Creb3l1/Tcp11 WHL22_19719_0.1 ENDOGENOUS CTGAGCTCTCAGCTCTCCAAGCTACAGTCGATCGTCAACAAGATCTCCAAACCAATCAAAGCTCACACAACTCAGACCGGTACTTGCCTCATGGTTTTAG
Creb3l3 WHL22_743120_0.1 ENDOGENOUS TGTCTACCTCAGAGGACTTGGACCTCTTGTTCGATGGCAGAGATCCGATTCTCTCGGACGAAATGATCTTCAGTCTGGATATCATCCAAGACAGTCAAGA
Ctcf WHL22_295495_0.1 ENDOGENOUS CAACAACAGGTGCTAATGGTAGCCATGCAAGACAATGGTCAGTTATCATCTATGGATCAAGGTGTGGCCCAGATTGCTTTCTCAGGAGCACCAGTCAATA
Cutl/Cutl1cl WHL22_223192_0.1 ENDOGENOUS CCCTGTTGAAGAGCTTTCAGGCTGAAGTGGATTCCTTGTCTAAACGAAGCAAAGCAGCAGAAGGAGCCTTCCTCTCAATTTACAAGAAACTCATCGATAC
Dach1/Dac dach_742644.1 ENDOGENOUS GCGGACTACACACGGTTTACACAAAACTGAAGAGACTGAGCATCACTCCGGTGGTTTGTAACGTAGAACAGGTTCGCATCCTGCGGGGACTTGGGGCGAT
Dlx XM_777652.1 ENDOGENOUS TGACTGGGATGGGTGCGATGAGTCAGACGAGGCACTACGGCTATCACTTTATGAACTCTTCCCTAGCCGGGCACCCTCCGATATACGACCATTCTGATCA
Dmrt GLEAN3_28120.1 ENDOGENOUS TTTCTCGCACAGACCGCCAAATCCTTTCCAAGCAGACGCCCTCCTCGGTCGGACCTCAATCTTCGCACCTTCCAGTCTGAGTGACCTTCATGTTGGTGCA
DmrtA2 WHL22_114846_0.1 ENDOGENOUS AGAGAATGAAGCGAAGGAACTTGGACTTTATTACGAGACTTCAGATGGTGCTATCTACGCGATGAATGGGATTGCTGTCCAGACACACAAGGGTTATGAT
Dmtf WHL22_529855_1.1 ENDOGENOUS AGGGTTTTCATCTTAGCGCACCTACTGACATTCCAGTATCAGGAAGCTCCCATGTGATGGGGATAACTTGTGTGCAACGAACTAAAGAGTCAGAGCCTTA
Dp1 WHL22_476402_0.1 ENDOGENOUS TAGTTTAACTAGCTTGTGGGGTCCTGAGGGTCAGGGTAGCCCATTAAAGACTCAACCATCGACGCCTTCAAAGTCATCGGGAAAAGATATCGTTGGTGAC
Dr WHL22_544154_0.1 ENDOGENOUS ATGGAATCACTTTATACCGCGGCAACAAAACATATGTCACCGAGGCATCTTGCTATGTTTGAGATGTCACGAAGAGAGATCCTCGAGAAATATATCCATC
E12 XM_001185037.1 ENDOGENOUS GCCAACAATGCAAGGGAGCGCATCCGCGTTCGGGACATCAACGAAGCATTCAAAGAACTGGGTAGGATGTGCCAGTTACACCTCAAGCAGGATAAGGCCC
E2f3 e2f3_742630.1 ENDOGENOUS CAGAATGGTTTGGACGACGACTTTGTTGCGCTCTCGCCACCGGCTGTGGACGACTACCTCTTTGCCTTGAACGACAACGAAGGCATCTCTGACCTGTTCG
E2f4 GLEAN3_28827.1 ENDOGENOUS GCCACTGAGTAGACATGAAAAGAGCCTCGGTTTGCTCACTACGAAATTCGTTGGTCTACTTCAAGAAGCACCAGATGGAGTATTAGATCTTAAGCAAGCG
E78 WHL22_454455_1.1 ENDOGENOUS CAAGTCTTCAGGATTCCACTACGGCGTCTTAGCCTGTGAAGGATGCAAAGGCTTCTTCAGGAGAAGCAGCAAAAGAGAAAAGGAGTACACATGTCGTCAT
E78a WHL22_454662_1.1 ENDOGENOUS CCGTATGACGTGTTTGTATACACCATCCAGTGCACCGTTTCTCAGGGGCTTCACGTTTCCTCAGGAAAATCAAAACTCTCACTTTCCGAGCGAAGACATG
Ebf3 WHL22_113329_0.1 ENDOGENOUS GTAACTTCTTCCATTTCGTGATCGCGCTCTACGACCGAGCAGGTCAACCCATCGAAGTCGAGAGGACATCCTTCGTTGATTTCATCGAAAAAGAAAGGGA
Egr GLEAN3_15358.1 ENDOGENOUS AGTTTGATCAACGAAGCGGTATCGGCTCAGCCTATCGTATCCTGCGAGACGGCTTGTTTCACACCTAGCTGCACCTCAAGCTTTCAGATCGCCAGCACTC
ElfA WHL22_629740_0.1 ENDOGENOUS GGGGATCCTTTCAAAGGTCGACGGGCAGAGGCTGGTATACAAATTTTGTGAGATACCAAAGAATATCCGTGAAATCGACTGCAGTTGAGGTATTTTGGAC
ElfB/ElfA GLEAN3_20123.1 ENDOGENOUS TTGATTTCAGCATGGGGCCATCAGATAAAACTTACCAGTCTTCCAGTAGTCCAGCAGTCATTGTCCAGATCAACGATGTCTTGCTTACACCAAGCGAGCT
Elk NM_214627.2 ENDOGENOUS ATCGTGAGAAATTCCAGTGGACGACGTCCTTACGCAGAGAAGGCGATGAGATGTTCTCAAGACCACCCGTGACAGTGAATGTTCAGGAGGTCTACATCAC
Emx XM_777915.2 ENDOGENOUS GGCACGGCGGCATCATCAAGCCTATGCCCACAGAGGCATCCTTCTTTAACACTCTCAGTGGAATGAAGGGACTCTACCACCCTGAGCCCATCTATCACAC
Engrailed WHL22_521432_0.1 ENDOGENOUS CTAGGCGGCCGCGAGCCGCGATCACCGACACCACACCATCACCCTCTCCATGTCCCTCGGTCCCACTCTGACAATGACCTCGCTGTCAAGACACGCTTCA
Enz1/Enz2 WHL22_223228_0.1 ENDOGENOUS CGGAGTGTGAGCGAAAAGAGTGAAAAGAACACCTTTACGGATCTCAAGTCTATAGTGAAGTCTGAGTACATGAGCTTGGTGGCTAACAGACGCTTCAAGA
Eph WHL22_110632_4.1 ENDOGENOUS CCAAGACGAGACCGGCCATGATTGTGACGGAATTCATGGAAAACGGTTCACTAGACAAATACTTGAGGGAAAATGACGGACGATTTACAGTGACCCAACT
Ephrin WHL22_763086_0.1 ENDOGENOUS TTCTGGCCAAGTCCGATGGCTTTGCCCAAGGCAAAATCAGGAATCATATTTTTTGTGAACGCTGTTCTTCTTCTGTGGAGCGTCACACTGGCGAAAACAC
Erf XM_788779.1 ENDOGENOUS GCGCTTCACCTACAAATTCAACTTCAGCAAGCTGATTCTAGTGAACTACCCGGGAACCGACCTCAAATATGTGCCTCCGTTCATCCCGCAATCTCGGGGT
Erg NM_214668.1 ENDOGENOUS TGTATAGGAAGCATTATCGGTAGTCTCGGACGACCAGACGCTATTTGAGAACACATACCGTGAGGTGAATAAGTCCAACACTATCGTCTCGTCGCCACAC
Err WHL22_91797_0.1 ENDOGENOUS CTCGCTGGTAGCAAAGGCGTTACATCTCACAAGAAAACTCAGGGACATTGGCATTGACAAGGAAGAGTACGCTCTGCTCAAATGCATCATACTATGTAAT
Ese ese_742603.1 ENDOGENOUS TCCGGGACCTTCTCAAGTCCGAATCCTACTGCCCGAAGTTTATCCGATGGGAGGATCGGGAAGCCGGAGTTTTCCGATTCGTCAACTCGGAAGCGGTCGC
Ets1/2/ WHL22_238821_1.1 ENDOGENOUS CTCTGATGAATGCATGCCTCAGAGAAAGCTTTAGCAGCTTCAAGAAGGAACAAGAAAGGCTTGGAATCCCAAAAGATCCGTCTCGATGGTCCGAATGTCA
Ets4 NM_214534.1 ENDOGENOUS TGTCCAGAAGTGGTTGTTATGCGTCGCCAATCGCTTTGAGCTAGGGGAACTCGAGATGGGCCACTTTTACATCAATGGACCAACCCTTGCAACACTCCAG
Eve NM_214651.1 ENDOGENOUS CCGACGCCTACTCACTCCACCTCCGATCGCGAGCAGAGCTTCTACATGGTCTCGGTGCACACCCTTACGCAAGACCGTTTCCAAACCCTGCTGCCGCTCC
Evi1 WHL22_227650_0.1 ENDOGENOUS ATGGAAAGGTTTACTACAAAGCCATTCATAACATAGGTACAGGTGAGGAGCTATTGGTACTCAAGGATGCAGCCTTTCCTGATCAAGAAGGCAACCCAAT
Eyg WHL22_568711_0.1 ENDOGENOUS CATGCTGCCATGTAATTCACGGGCCTGCGATCTCACTCACCCTCTACTTTCAATACCACAAGGTTACTCCGGTAAACTATTTGGCCGCCTATACGAACCA
Fn3f_67/Fgfr WHL22_323968_0.1 ENDOGENOUS TGCGATATTATGTGTAATATGCAGTTGGACGTTATCAACGGCTGGAGCAACTACAATACGAGATAAAGAAGTAAAACCAGATGCTCCTCAGAATCTAACA
Fog WHL22_591129_0.1 ENDOGENOUS CGACCATTGGACCCTTCTCTGCGAGGATTGAATTGGTGCAAGAGGAATGTGTCCGGGAGAATTCGATCTGTGTGAGGGGTTCAAGCAAAGCTCTATTTAG
Fos WHL22_538480_0.1 ENDOGENOUS CTACCCAGGATCATACAGACACCGTCTTCCATCGTTCACGGAGAGCGATTCCCAGTCGTCGACTCGCGACACGTTGTCGGACGATACAGCGTCACAGTCG
FoxA WHL22_439762_0.1 ENDOGENOUS CATCCAGCCAGTATGCTAGGAGTAGGACAACATCCATCCTTCGCACATTCACATCCATTCTCCATCAACAGTATAATCTCACCTGAACATAAACTGGACA
FoxABL WHL22_615153_0.1 ENDOGENOUS TATGAACGTCTTATTTCTGACTCTCACCACCGCTATCACAGTACAGAGATAACTGGAATATACGACAACGACAGCGGTTGTGATTACCGCATCAAATATG
FoxB NM_214632.1 ENDOGENOUS ACAGTGATGCCAAGCCGCCATATTCCTACATCTCCCTAACGGCTATGGCTATCCAGAGCTCGCAGGAGAAGATGCTACCCTTGAGTGATATCTATAAATT
FoxC DQ286740.1 ENDOGENOUS ATCAAGGAATGGCGATGCAACCTTATCATTCAGCGGCTCCTTCCATACCTGGCGTCATGCATTCGGTGTTTCCACCAGAACAGGGCTACTATCGGCACCC
FoxD/FoxD_1 DQ286738.1 ENDOGENOUS AAGAGGCAGCAACCAGACTTTTTCAGGGAAGCGGGGCATTTCATGACGGGTCCATATCCTATGGGGCGACCAGCATACGGTTATGCGATGGCAGGACTTC
FoxF DQ286741.1 ENDOGENOUS TATGATCGGTGGCCCGATGTCGCCACACCTTGCGAACAGCGCACCGAACGCCTGCTCGCCCAACGGTGGATTCATGACTAGCTGCTCGATGGCGGGTGGG
FoxG WHL22_389872_0.1 ENDOGENOUS CCCATCTCCATCATCCTGTCATGACCAAGATACATGAGCCCATTATTAGAATGGAGTCGCCTCCCTCCAATCAGACTTCCATCACTGAATCCGAGAGTTT
FoxI XM_001181648.1 ENDOGENOUS GAATGCAGCCGCCGCATCGACTTTAAATAGTGAGGTTCCTGCATCCCATCTCTCTCCCAACGATATAGCTCATAGCAACATGGCAGCTCTGAGGTACTTC
FoxJ1 WHL22_468365_0.1 ENDOGENOUS CATCACAATCACCACCATCTTCATCAGAGTCCCATCCAACTGGACCAAAAGATAGACTACAAGACGAACTCGAGCATTAAGCCTCCGTACTCTTACTCGA
FoxJ2_1 WHL22_767230_0.1 ENDOGENOUS GCAGTCGCAGCAACAACCTCTACAACTGTCATTAGGAAATACAGATTGGATGAATAACCTTGACATTCTCAAAGAAAGTGTGCGGGTTGCAAGCAGCTAC
FoxK DQ286748.1 ENDOGENOUS GTCAGAGGCTAAACTAATGGATCAAGCTTACAGAAGAAGACGCCAAAGGGGAGTGCCGTGCTTCAGGACACCCTTTAGCGGGGTCTCATCAAGCCGCTCC
FoxL1 WHL22_639477_0.1 ENDOGENOUS CCCAATAATCAGATTAACAGTTCAAATGACGTAACCAAGCAGAACGACAAGGATAACGAGGAGGAGAATGAACCCAGTAAAGACTCTTCGGATACAATTA
FoxL2 WHL22_159450_0.1 ENDOGENOUS GCTCGTACTCCCAGTTTACACCGTGCACGCTCTCGCCTTCGCCTAACACGGGATATATTTCGTCGGTTGGGTTGTCGCAGAACTCGGCGATCTCTAGCGC
FoxM/FoxM_1 XM_001200365.1 ENDOGENOUS AATGCTTTGCTCCTGAAGGCTCCTTTGACATGGCTGCGATGGCAAATCTTCAAATGCAAGCTCTGGTCGGCGATCCTAGCAGAATGCCCATGTTATCAGC
FoxN1/4 WHL22_604594_1.1 ENDOGENOUS ATCAGTCAATGATGTGTTTGCGAATGAAGTTCAGAGTGAAGTGAACGAGATTTTGAGGTCTGATGCTGCCCGATTTTCGCCGCAGTCCTCGATGGATCTC
FoxN2/3 XM_790403.2 ENDOGENOUS ATGATCCAATGGACCCGCACCGACACATCAATAGCAAACCTCCTTTCTCATTTAGCTGCCTCATATTCATGTCGATAGAGGACTGCCCTCTTAAGCGTCT
FoxO/FoxO_1 WHL22_241099_0.1 ENDOGENOUS TCTCAGTCCTGCCGTCCTGGCTGAGGAACCGCTTGATATTAAACCAGTTTTACCTTTAGAAGGCGGAGAAAACCGTGAATTATCAACACCATCTTCACAG
FoxP WHL22_621648_0.1 ENDOGENOUS ATGAAACCTCTCAAAATGGCAGCCAAAATTCTTCGAAATGCGACGTCCATGATCTACAGGAGGACATCTCTTGCGAGTTTCAGTGGACAGACTAGTGTTG
FoxQ1 WHL22_145751_0.1 ENDOGENOUS CGAGACCGTGATTTGGTGCCCAGCCGAAGACGTTATCGAGTCTCACGGTGATGACGAATTAATGACGAATACGTCGACATCGTCGTCGTCAAGAAAAGGC
FoxQ2 NM_001079550.1 ENDOGENOUS CATTTCTGGGCAATCCATCCCGCTAACCTTGAAGACTTCGCCCGTGGTGATTACAGGAGACGGCAAGCTCGTCGCCGAGCACGATCAGTCAGTTATTCTC
FoxY WHL22_399521_1.1 ENDOGENOUS TCCACCACGGAATGGAAAGAAACCATCGCGGGTCGATCTCCCGGGTTTTACCTACGCTGAGCTGATCACCATGGCGATTCAGTCGTCGCCTTCTCGTATG
Fra2 WHL22_538597_1.1 ENDOGENOUS GTACCCAACGATCAATATGCCTGCCGATGATGGTATTCAAGATCTGTTGACTACTATGGCGTCTGGTTGTATGCCCGCTACCAGTGAGGATTATACCGCG
Frizz WHL22_45238_0.1 ENDOGENOUS CTGCGAAGCCATAACAATCCCGCTATGCGAGGATATGCCGTATAATATGACGATCATGCCAAATCTTCTGAACCATCAGCACCAAGAGGATGCAGGGTTA
Frizz5/8 WHL22_42488_0.1 ENDOGENOUS ATGCTACTTCATGGTCGCACTCGGCTTCATCATCCGTCTCGTCGTCGGTCACGAGCAGGTAGCATGTTCAGGTCAATATGTTCGTGTAGGATCGACGGGT
Frizz9/10 WHL22_60681_0.1 ENDOGENOUS TTCGTGTTTTCTTGATGTGGGGTTGGTGTTGTGGCAGCTATGGGCTTGGTGTGCGTCATGGAAACACACAGGGACATTGCGAAAGGATCACCATTGATTT
FtzF WHL22_765708_1.1 ENDOGENOUS TGAATCGTGAGGAGACAGGCGTTAAAATTTCGAATTACAGGGATTACAACGCGTATCATCGCTACAATATGCCGATGTTACCCGACCATGCCGAGTACTT
Fxr GLEAN3_11348.1 ENDOGENOUS TGGAGATACCAGGTCCTGAGGACCTCAAGAGAGTTACGCCATGGAAAGAGGGCCAGAACTCGGGGCAAGACTCTAGCGATGACAACGGGCCCAAATCGGT
Gabp WHL22_120896_2.1 ENDOGENOUS CAAGAACAAGAAAGCAAAGGTGGAATCAATCAACTTAGCCTCTCAGAATGTCATAACTCAGATGATGGATATTGCCCAACCTCTATCTACTTTGAAGAAG
GataC WHL22_660411_0.1 ENDOGENOUS CTGGTGCTTGGTGTGGTGGTCCATTTGGTAGTTCAGCACCTCATCCCGGTCCAACAAGTTCCTACACGTTACCGGCATCGACGCCGATCCAGCCGAGTTC
Gatae/GataL NM_001005725.1 ENDOGENOUS ACCTCTCATCAAAAACCCAAGGAGATTGCAGTCTGGCTCAAGACGAGAAGGAATTACATGTGCTAACTGTCACACTAGCACTACAACACTGTGGCGTAGG
Gcm NM_214661.1 ENDOGENOUS GTTCGGGAGAAATCGTGACTGTTCGGCCAGCCACTTCGGATCGTGCTCGGAAGAAGCAAGGCGATAAGAAATGCCCAAGGACCGGTTGCGATGGCAAACT
Gcnf1/Gcnf1_1 WHL22_765489_0.1 ENDOGENOUS CTCTTTGAACTCCTCTGCAAGCTCATGGACCGGATGCTTCATCACCAGATCCAGTGGACCAAACGGTTGCCGTTCCAGTCCAAGATCCCGATCTCCGATT
Giant WHL22_668554_0.1 ENDOGENOUS ATGGAATCTAAGGAGGTCATCGAAGTTAAAATGACAAAGCCAGAGAAATCCGACTCATTTGAAGTCATCACTCCAGTTAAACCAGAGAAGATGAAGAAAT
Glass2 WHL22_204563_0.1 ENDOGENOUS CTCAGCGCCTACAACACCGGCCCACAACCTATGAAAAACCTTTCACTTTATCCTGAAAGTGATTTCACGAGACCTCAGACGAATCACATGACCACACTTC
GliA GLEAN3_17627.1 ENDOGENOUS GCTTACTCTCGACTTGAGAACCTCAAGACTCATCTTCGATCCCATACCGGTGAGAGACCGTATGTCTGTGAGTTCCAGGGATGTACCAAAGCCTTCTCTA
GlisB WHL22_583631_0.1 ENDOGENOUS CATTCTGCAAGGTCTTGGACTTCTGCGTGGGGGTCGAAGAAACGATCATTGTCCATTTCTCCACTCTCTTCAGAAGGCATGGACTTGAACTCTCTCATTC
GlisC WHL22_66475_1.1 ENDOGENOUS CAGCACATGACGTCCATCAGTGGAAAAGACGGCATGATAAATCTAAGCAATATTTCTTCCTGCAAGTCAAGTGGTTCCATAGGGTACACAAGGACCATAT
Grf WHL22_274118_2.1 ENDOGENOUS AATAAACTTTCACCTCTAAGTGATGTCAGCAACAACAACGAAGAAGATCCCTCGGTCTTGAAGCTTCCACCCTCCAAGAGATGGAGAGGAACATTTCACA
Gsc NM_214498.1 ENDOGENOUS GTTCAAGAACCGCCGAGCTAAGTGGAGGAAGCAGAAACGGGAGCAACAAGAGGCTGCCAAACGGGCTTCCGAAGCATATAAAACCGAGTACGGGTCCAAA
Gsx WHL22_585269_0.1 ENDOGENOUS CACCTCTAACTCCAACCAACGGTACTGATCATCCTCGGACACCAGTTTCGATTCATCATCATTCCAGGACATCACCAGATACCAAATCGGCCACTATCTT
Hairy WHL22_143140_0.1 ENDOGENOUS GACGTCGAGCTCGTATTAATGACAGTCTTCTACAGCTGAAGAATCTGGTTCTCGATGCTCTCAATAAAAACAATCCTCGTCATTCCAAATTGGAGAAGGC
Hairy2/4 NM_001001768.1 ENDOGENOUS GCTGTCAACAACACATCGCAGGTCACGCAACCGATACGCGTTCAGATCTCGCAGGCGACCTCAACGGCGTTAAGTTCATCAAACGGCATCGTGACATCAC
Hb9 WHL22_107381_0.1 ENDOGENOUS CATGGGGTACGGAGCGGCCACCCGCTATCTTCTTTCTCTGTCGACTGGTTTCGTAACGGCGTCATGCTGCCCAGATTCGGAGACTTTGCAGGAGGTTTTG
Hbn XM_775964.2 ENDOGENOUS AGGCGCAGCAGCGGCTCACGACGGCGCCAAGCTCTCCCATTCCCTTCCAATCTCCATCCCGAAACTCTACATGTCGCCTGCCGAGAAAGGAAGGAGAATG
Hes GLEAN3_21608.1 ENDOGENOUS GCAACATCGCCAGTCCAGCAGTTTGCTACAACACCAAACGGCATGGTTCTCCTCCTCCCAGCCCACACCGTCCAACACAACTCGGTCATCTCGGTTCGAG
Hey WHL22_578435_1.1 ENDOGENOUS CTATCAGTTGGTCACTGGGACATGAAAAGGACAATGAGTGAATCAGAAAGTGACGAATTATTTGACGAGACCATGAAAGGATCACCGAGCCAATCATGCC
Hey4 GLEAN3_15712.1 ENDOGENOUS ACCCACCAGACCCAAACACTCAAGTGCAATTTAGGTCGGGGTTCAACGAGTGCATGGCAACCGTCACCCAGTTTCTTTCGGCAAATAATGGCTCGCTGAA
Hhex hex_742618.1 ENDOGENOUS CACGTTCCCGGGGCATTCGTTCGGACCGTCGCCGTACGGACAGCCTCAGCATCCGACCGGAGCTTACTACGATCCCGCCGCCTTACCTGGTGGGCTGGCT
Hlf XM_001175813.1 ENDOGENOUS GTGCACCTTTACCGCGGAGGAGCTCAAGCCGCAGCCTATGATCAAGAAGTCACGAAAGATCTACGTGCCCGATGAGCAGAAGGACGACAAGTACTGGGAG
Hlx GLEAN3_14802.1 ENDOGENOUS TTTTCCAGCAGCAGACTTTGACGCTAAGCGCGGAATAATTAATCCCTCGCGACATGGAGACGACTTAAAATCCCAAATTACCGTGGTGATGCAAGCTCAA
Hmbox1-2/Hmbox1 WHL22_285632_0.1 ENDOGENOUS CAGAGGTGGTGTTGATGACTTCCACGTAACCAATGAGGAAGTAGAATCTCTCTTCAGGAAAGGTCACATGAACGTGAAAGAAGACATCAAGGATTTCCTG
Hmg2 XM_001176404.1 ENDOGENOUS GTACAGGATCGGCGCAGTAAAGCTGAAGGGCAAGTGAATTTCACCGCTTTCTCTAAGGAATGTGCTGATAGATGGAAGCATATGGATGATGGAGACAAGC
Hmx GLEAN3_12490.1 ENDOGENOUS CGATGTCGCCATCCAGTCCGTCGATGTCCAGCAATGGGTACAGTGAAGGGCCCATATACGGCTCCACTCGACACCCACTATCGGCGACCGTTCCGGGCTT
Hnf1 XM_001201193.1 ENDOGENOUS GAGAAGTGGTAGATTCCACAGGTCTCAACCAATCACATCTCTCGCAGCATTTGAATAAGGGCACGCCCATGAAGGGCATTAAACGAGCCGCTCTCTACAA
Hnf1aL WHL22_520179_0.1 ENDOGENOUS CTTGGGCATCGTACTCATCAACCCTCATCCACAATGCAAGCTCTTCAGCAACATCAGCAACAACAACAGTCAACCTTGCATCGCATGATGAGAAACAATC
Hnf4 GLEAN3_21192.1 ENDOGENOUS TGCGTGGTGGACAAGGACAAGAGGAACCAATGCAGATACTGCAGGTTAAAGAAGTGCTTCAGGGCTGGCATGAAGAAAGAAGCTGTTCAGAATGAGCGGG
Hnf6 NM_214659.1 ENDOGENOUS ACCTGATACCCATTCGTCTTCAGTAGCACCCGGCTTAAACCCGGGCGATTTCTTTAACGCCACGGATTTCGCGGTGAGTCGCCACTCCAGACCCGGTGGA
Hox1 WHL22_630296_0.1 ENDOGENOUS GCCATCTCGTATCGGGCATCGGAGTTCAAAGCACCACTAACTCGTACTCACACCTTGGTGATAGTCGACATCGACTTCACGATTACAACCCGCCATCGAC
Hox11/13a WHL22_629879_1.1 ENDOGENOUS GGCGAGGGAGGAGAACGAGAGGAAAAACCATTCGCATCATCCCGCCGGACAACATCACCCACAACACCATCATCATCTCGAGTCGAAGGGCGGTGACCAC
Hox11/13b NM_214609.1 ENDOGENOUS AACGCCGTCCATACTCCAAGTTACAGATCTACGAACTAGAGAAGGAGTTCACAACTAACATGTACTTGACCCGAGATCGTCGCTCGAAGCTCTCACAGGC
Hox3 WHL22_630100_0.1 ENDOGENOUS CGAGCCGTTTCTCTTCGGTTTCCACCCGGGTAGCTCGCACCACTCCGACAGGTCATTTCGCGGGGCGCCAGCCTACTGTCAATTCTCCTACTCGTGTACA
Hox5 WHL22_502907_2.1 ENDOGENOUS ATGCTGCTTTCTACACTGCTCGTCTTCTGTCTGGTGTCATTCAGCCGGGCCACTGGCCCAGTGGTAATGACTAGTAAAGGACTCGTCAAAGGATTCGTTG
Hox6 WHL22_629690_0.1 ENDOGENOUS ACCAAAACTCACAACACTTTTCCCAAAGCAACCTCGACAGTACTTTCCCATTTTTCATGCCTCACCAGTTTTACCCTCACCACACGTCCGACTCGTACCC
Hox7/Hox7_1 NM_214560.1 ENDOGENOUS CGAGGATGGCCGCCACGTATAATTCAGCGTCGTGGGGCAGCACGGCGGCGGAGTTAGGGGACGGGAGCTACCGGGGTAGAGTGAGCGCACTGACTGCTGG
Hox8 WHL22_629711_0.1 ENDOGENOUS TGAGCTCAATGTTTTTGAACTCACTATTCACCAAATATCAACCGGGTGAAGCGTGGTTTCCCAGTGGCTTCGATCCCGCGGCGAGCGTTGCCAGCAGAAA
Hox9/10 WHL22_629725_0.1 ENDOGENOUS TGACGTCATCAGATGCATGAATAATATAAGATGCAACATGCTTAAAGGGGTGGGAGGGCGGCGGTGCAAACTCTGGATAATTGTTGGATCACATTTAGTG
Hypp_142_1 WHL22_755982_0.1 ENDOGENOUS CCTGTATCAAGTTGGGAAGACACCAGAAGTATACTACGCATCTCGTTGAAGATGGGAGCAACTCTATAAACACAGCAGCTCATCCATCTTTGTGGACAAA
Hypp_142_2 WHL22_755991_0.1 ENDOGENOUS AGGCCCAGCCTCAAGGCTCCAAGAGCCCGCTACCAACAGGGTCATAGTCGCTCGGACTATCAGCAAGCCCTTACCATCCAGTTCCACTCCGTCCTCATCG
Hypp_1837/Oct1-2 WHL22_67463_1.1 ENDOGENOUS AAGATGACGATCAAAGGACAGGTGTCCTCATCATGAGCACTGAGACAGCAGAAAACTCTCCTGCGAAGAAAAGTAAGGAGGTTGTGATGATACAAGCAGG
Hypp_2032/Ovo GLEAN3_12448.1 ENDOGENOUS ATACTGCTACAAGCAGCGCCGTTCCAAGATATTTGTCTGTGAGGAATGCGGCATCACGACCGAAACCGCCGATTTTCACTACGACCACATCAAGGAGATA
Hypp_2213/Apa WHL22_771305_0.1 ENDOGENOUS GTTCTTTACAGTCCAGGCATTGAATGTACACAGCAGGATTCACACTGGGACCAAACCTTTCAAGTGCACTCACGATGGCTGCGATAAGAGCTTCACTACG
Hypp_2792/Gbx GLEAN3_25492.1 ENDOGENOUS TTGCTGGCTCTGGAAAAGGAATTCATCGGCAAAAAGTATCTGACGCTGAGCGAACGCGCACACATCGCACGCTTTCTGCAATTGAGCGAGGTCCAGGTTA
Ia1 WHL22_769122_0.1 ENDOGENOUS ATGCCGCGTAATTTTCTTGTGAAACGGACCAAGAGAACTGGCAGCGTGACGTACAGACAGAGAACTTCTGACGAAGAGTATGATGATCTTGGCTTTGTTG
Id XM_775662.2 ENDOGENOUS ACGCGCCGGAGTCTCGAACTTCACCATGTCCGATTGCTACGAGAAACTGAAGCAACTTGTGCCGACAATCCCGAAGAACAGGAAAGTCACACGAGTGGAG
Irf WHL22_263123_1.1 ENDOGENOUS ATGCAGGAATACAACACAACGAGGACCGATCGTTTTCCGGCGACTCCTAACGAAATGCCTGGATTGATTATGACACATGTACCGTCAGATCTGTCCCGAC
Irf4 GLEAN3_26877.1 ENDOGENOUS CCCGCGAGTACATCGGCAAGATCCTGGATTGTTGCGATAAAGGATTGTCCTTGACATGCCGTGATGGTTGTATCTATGTGAAGCGTCACTGCCGCAGTGT
IrxA irxa_742615.1 ENDOGENOUS AGGTCCTAAGGATTCTGAACACGGCGCACTTAGGGATGATTACCGAAGAAGAAGTGGAGAATTGTTAGCTGAACACCACCGACTGAGCGGATTGAATGGC
IrxB WHL22_496846_0.1 ENDOGENOUS ACATTGAGAAGTCATGCGACCAGGATCATGTGGATACGAATGAAAAGACAGCAGGAAGAATAGATTTGTGTCAAACACATAACTTGAGGATGAAGGCTCG
Isl/ WHL22_143854_0.1 ENDOGENOUS GGAATAAGATCTACCACATAGACTGTTTTCGTTGCGTGGCTTGCAGCAGGCAACTCATTCCCGGGGACGAGTTTGCGCTCAGGGAAGACGGTCTATTCTG
Jun GLEAN3_03102.1 ENDOGENOUS AAAACCAGGAGCGCATCAAGGCTGAGAGGAAAAGGCTCAGGAATCGAATCGCCGCCAGCAAGTGCCGCAAGCGCAAGCTTGAGCGTATTGCCAGGTTAGA
Klf11 WHL22_59256_0.1 ENDOGENOUS CTGACTTCGACGCCGTTCAGACTCTCTTGTCTATGAGGAGCGTTCCTTCTCAAGTCACCATCAAACGGAGCGATTCTCCCGTGCCGTCGTCGTCATCGCC
Klf13 XM_777064.2 ENDOGENOUS TCACATCTTAAAGCTCATCTCAGAACACACACAGGAGAGCGACCATTCCCGTGTAACTGGCAGGACTGTAACAAGCGTTTTGCGCGGTCTGACGAGCTTG
Klf15 WHL22_441254_0.1 ENDOGENOUS GGATTCAAACAGTACCAGCTCAATGTCCGACATCGACATGAGTGAACATTCCAGCCCTCTCAGCTCCAACAGCGATGATGATTTGTTTCTCGATTACCTC
Klf2/4 XM_776508.2 ENDOGENOUS GGGAAACCACTGCGACTTTTCATACGAGATTTGGCCTGATATGGAGAGCTTTCTTCAGGAGATCTGTCCGCCAAACAGCTTTGAGGAGCCATCATTTGCC
Klf3/8/12 GLEAN3_17470.1 ENDOGENOUS TCTGACGAACTCACCAGACACTATCGCAAGCATACGGGTGACAAGCCATTCAAATGTACTCACTGTGACAGGGCGTTCTCAAGATCGGACCATCTCTCGC
Klf7 XM_787725.2 ENDOGENOUS AACAGAAAATTACAAGGCGGCGAGAATGATATCTGAAGCGACCCTCACGCCACCATCATCACCTGAACTTGGTCGTAGCCGCTTAGTGAGTGTGCCTGTT
Krl/Z474_1 WHL22_335235_0.1 ENDOGENOUS TCGTCGATCATCCGTTGTCAACTGGCTGGTTTCGTCGTCGTCGTCACCGTCAACGGCTCAACCTAGCGGTGGCGTTAGCTGCGGTCCAGTGCGTAAGAAC
L3mbt WHL22_447114_2.1 ENDOGENOUS CGGTATGAAGTTAGAGTGTGTTGACAAGAGGAATGCGTCTCTCATCAGAGCTGCTACCATCACAGAAGTAGAGGACTACAGGATGCTGATTCACTTTGAT
L3mbt_1 WHL22_727178_0.1 ENDOGENOUS CGTTCACAACACTTATAATAGCTCAGCAGAGGAAGAAGTAAGCAACGATTTTCCTGAAGAACAAATGATGCCTTCAAGTAATCTGTACAGTCTATACCTG
L3mbt_2 WHL22_727184_0.1 ENDOGENOUS GAAGATAACCGAACTGCATCTGACAAAGTCTCTGCATTGGATAGACTGTTGGCTAAGTCTGTCGATGATAGCGTTTCGGTGAGAGTAGCTCCTTATACTG
Lass6 WHL22_41285_4.1 ENDOGENOUS ACCATGGTTCTGGGACCTTAGACTATGCTGGCAGCATTTTCCATTCCATCCGGTGACAACAGAGATCTACAACTACTACATGATCGAGATGTCTTTCTAT
Lbx WHL22_489358_0.1 ENDOGENOUS ATGGAAACGATGGCGGGGACGAACACGATAAGATGAGCGTTCATTACGTTGATTCGGACAACGAGGAAGACACGAGCATGTCGATCTCCAAATTGTCTCC
Ldb2 WHL22_386521_1.1 ENDOGENOUS CAGTCAGCCCGACTACAGAATATATGATCTCAACAAAAGGTTACAACAGAGAACAGAGGAAAGTGATAATCTCTGGTGGGATGCCTTTGCCACAGAATTT
Lef1/Tcf NM_214475.2 ENDOGENOUS TCAACACCCAAGAAGTGTAGAGCGAGGTTTGGTGTGGACCAACAAGATTTCTGGTGTAAACCTTGCAGGAGGAAGAAGAAGTGCATACGATACATCTCAT
Lhx3-4 WHL22_691261_1.1 ENDOGENOUS ATGAAACAGGACTTGTTTATCGGAGGACCTCTCCAGATTGAGCGAAACATGCCACAGGCGACCAACGATTCATTTCAAGAACAGAAATCCATCTCACTGT
Lim1 WHL22_720614_0.1 ENDOGENOUS GAACGGCCCATCTTAGATCGTTTCTTGCTCAACGTACTGGATAGACCCTGGCATGTCAAATGTGTCCAGTGCTGTGAATGCAAGGCTAAACTCACTGAAA
Limc1/Lhx2 lhx29_742607.1 ENDOGENOUS CACTACGAAACCCTCTTCGTTCCGTCCTCCGATCAGAGCACCTATCACCATCTCCACCACGCCTCGCCTCCTCCTCCGCAACCAACCCTCCATAATCTCT
Lmo2t WHL22_43544_0.1 ENDOGENOUS CTCAACGTGAATCCTTCGTACCTGGAGTGCCACGGATGCAAAGAGTCTATCAAGGACCGCTACTTCTTAAGAGCCATTGAGAAGTATTGGCATGAAGACT
Lmo4 GLEAN3_19586.1 ENDOGENOUS TGGATCGATTCTGGCACACGGGGTGTCTCAAGTGTTCCTGCTGCAACGTTCAACTCGGTGACATAGGACACTCATGTTTCTCGAAGGGAGGGATGATTCT
Lmpt WHL22_543989_3.1 ENDOGENOUS ATAATATTAAGAAGAGGCAGAATTCCGCCTTTGAAGAGGTGGATAAAGGGCAGCCCTGTTTGAGCTGTGGAGATAAGTGCCTAGGATTTGTGCCACATAA
Lmx1 GLEAN3_14157.1 ENDOGENOUS ACCTCATGAAAGTAATGGATCACTGCTGGCACGAGCAATGTCTTCAATGCAGCGTCTGTAGAATAAGACTATCACACTCCTGCTTTGCCAGAGATCGCAA
Lox NM_214650.2 ENDOGENOUS ATGGAAGGGAACAATCCCGCGTACTATCACTACATCCCTAAGGGACAATTCCCGATACCTATCACCACGGGTGAAGTTAGCAGCTTTCCCTCTAGCTATA
Lztf1/Lztf1_1 WHL22_224817_1.1 ENDOGENOUS GACGTGGAGGGCAAAATGAGTGCTCTTAAATCTCAAATGGAGCAGAATATGAAGCTGACCACCGATAGAGCAAATACAATGGAAGGAGACCTTATTTCTT
Mad mad_742627.1 ENDOGENOUS ATCTGAAGGTTTTACCTCGCACAAAGACCAGCTATGCAGAGAACAGCGCTTCCTCAGAAGGAGATTGGATTACTTACAGTCTACCTTGCACAGACAACGT
Maf WHL22_652540_0.1 ENDOGENOUS GGCGGAGTCCGCCGACGGTTGCGGTACCTTCAATGATGTCGATGCTTTAGCTATGGAATATATCAGAAACTTTGACTTGAGCCTCTGGCAGCTTGGGGCA
Max max_742599.1 ENDOGENOUS TTGGAGAGATCTTCGACAGGGGAAGTAGCCAAGACCAACGGCATCATTCTCAACACCAAATTATCTCACTACGACGCCGGTTCCGAATCCGACTCGAACT
Mbx1 GLEAN3_11297.1 ENDOGENOUS TAGAAGATGATTTGGACGACGGTTGTCGAAGGCACCCGACGACGGACTTTAGTCGCGAACATTTTCACGCAGCGATGATCTCTCCGCGTTCCGACGGCGT
Mef2 XM_790894.2 ENDOGENOUS TGAGTCCTACATCCTAACGCCACGCACTGAAGCCAAATACCAGAAGATCAATGAGGAATTTGACAGAATGATGAATGGTGGAAGTGGGCAACCCATGAGC
Meis WHL22_2236_1.1 ENDOGENOUS ACGCTCAACCTCACATGAACCACGCACCATCCGTCGCTCATCCACAATTTTACCCTGGACATACACCTTCAAATGTCATTACTCCATCGGTCACACAAAG
Mist_1/Mist WHL22_490847_0.1 ENDOGENOUS CGAGACTCTGACTCTAGCCAAGAATTATATTTTAGCACTGTCTGACATGGTAGTAGGACTCAAAGCAGACCTTGATCGTTTATCCACTGAACACGGGATC
Mitf XM_777978.2 ENDOGENOUS CAGGTCAAGACAGAACCGTTGGCTTACCCTGAAGAACATGTCCGAGCCCATGCCAAAGAGCGACAGAAGAAGGATAACCACAATATGATTGAGCGAAGGA
Mll3 WHL22_653011_1.1 ENDOGENOUS GTTATGGGGGTAGTCTGATGGATGAGAACCAGTATGACGATGATGTGATGGATTGTAATAATGGCAGTGATCCGAGCTGTTCCCTCTGCTGTTGTGGTGA
Mll4L/Trx2/Mll1L WHL22_568858_2.1 ENDOGENOUS AGATATGGACGATCACTGGTGCGATATCTTCCAGAAAAAGATAGAAATCGTCAGCATGCATTCTTTGCACGTACAGCAGCCATCCAGAGAAATTTGAAGT
Mlx XM_788213.2 ENDOGENOUS GCTAGTTTTGCAGAGCTTTCGGCATGTGTATTCAGCTGGCTAGAGGAGTACTGCAAGCCTCAGACACTCCGAGAACTGGTTGCTGAAGTCTTGAGGAAAG
Mlx/Ip WHL22_419504_0.1 ENDOGENOUS CCGTCGAGTGAGACCATACATTCGGGTCATTTTATGGTCAGCAACCCGCACAAAGTGAAAAAGAGCGGCGGCTACAATTTTGACGATGCGACCAAGGAAA
Mnt WHL22_677195_0.1 ENDOGENOUS CAAAGATAAAAGGGCTGGAATCAGAGAAGTACATAATAAACTGGAGAAAAACAGACGGGCGCATCTGAAGGATTGCTTCGAAAACTTAAGAAATACTGTT
Mox_1/Mox WHL22_737621_0.1 ENDOGENOUS CATAGTGTCGAACCACAGTACGGATAGCGCGTGCGGTTTGGACAACGGTTCAGACGCGAGTAATTACGGCGGTTCGGATAATGGGGATCCAAATAGTCCG
Msx NM_214613.1 ENDOGENOUS CTCGCTCTCGAGCGCAAATTCCGCCAAAAGCAGTACCTCTCGATAGCCGAGCGTGCAGAGTTCTCCGCCTCGCTCAACCTCACCGAAACTCAGGTCAAGA
Msxl WHL22_404908_0.1 ENDOGENOUS TGGCTCTCTTAAATTCTGCTTATTCGCTCCAGCAGGGGTTCTACGCCGCCGGGGTCTTCCCGGCGCCACTATCTAACTATTCGGGCTTTTCTTTAGTCGG
Mta1_1/Mta1 WHL22_580176_1.1 ENDOGENOUS GCAGTGCAGGCTCTGTGCAACTTGCTGGGTGTACTGGAAGAAATGTGGTGGACTTAAGATGCCCACTAGACTGGATGGGGAACGTCCTGGTAACCTTAGG
Myb XM_792258.2 ENDOGENOUS ATGGCCCTAAGCGTTGGTCTCTCATCAGCAAGTTTCTGGTGGGGCGCACAGGCAAGCAGTGCAGGGAGAGATGGCATAATCATCTGAATCCTGATATAAA
Myc WHL22_687558_0.1 ENDOGENOUS CCCTCTCTTTGCGGACTCTGACAAACTCCAACGCGTACTCTCTGAGATTCTTGAAGACGAACCGGTATGGATGACACAGAGTTTAACATTTGTTGGTCCC
MyoD WHL22_295720_0.1 ENDOGENOUS TAGTCCAGGGTCATATTCATCAGACAAAGCACAGCAATACGGAGATGGTTATGACGTTTCGTCACCCTACGGTTACAATGGTTGCGGGAATGCTTCAAGT
MyoD3 WHL22_531810_0.1 ENDOGENOUS CCGATGACAACCAACTATACCGAGATCACTTCGACATCAATGACGACCGAACCTCGACATCGCTGAACTCGCTTGACCAGTGGGACAGAAACATATTTTT
Myor2 GLEAN3_12008.1 ENDOGENOUS CTCGGATGCGAGTGTTAAGCAAAGCCTTCTCCAAGCTGAAGACGAGTCTGCCGTGGGTTCCGCCAGATACGAAGCTCTCTAAACTAGATACACTTCGACT
Myor4 WHL22_49654_0.1 ENDOGENOUS CATCATCGGTTGAAGGCCCAAGGATATCTTCATCCGGTCAAGAAATGGCCAATGCGATCCCGTCTCTACGCCGGAGCTTCAGCGGACCGTCTCTTAGATA
Ncsl WHL22_131182_0.1 ENDOGENOUS AACGGCGAAATACCGAACTGCGCACGCGACGCGGGAGCGGATACGTGTCGAGGCTTTCAACGTGGCCTTTACGGAGCTGAGGAAATTGCTGCCGACGCTG
NeuroD1 WHL22_694980_1.1 ENDOGENOUS TCGAGACTCTACGCCTCGCAAAGAATTACATCCATGCTCTAGCTGACATTCTCAGGACAGGTGTCGTTCCCGACAACATCTCATTCGCGCAGACATTATC
Nfat WHL22_538507_3.1 ENDOGENOUS ATGCTGAATGAAGATTCTGAATGTGGAGACCTTATAGTAGCTGGTGAGGTAAGTGGAGTGGATGATTTGGACCATGGGTATGACACAAACTCTGATTTGT
Nfe2 XM_001187612.1 ENDOGENOUS AAAGAAGTCAATGAGATGCAGCAGAGGTATGCAGAACTCTGTGAAGAAGTCTTTGCCTCGGTTCAGGATGAGCATGGTAGCCCAGTTGATCCCAATGACT
Nfia WHL22_579762_0.1 ENDOGENOUS CTTGGTCATGGTGGTACTCTTCAAAGCGATTCCGCTGGAGAGTACGGACGGGGAAAGGCTGGTCAAGTCGCCCAATTGTACGAACCATACATTATGTGTA
NfIL3 WHL22_733532_0.1 ENDOGENOUS TGGAGAACGACATCATAATGCTCGAGAACAATGCATCCAAGAGTGAAATTCAGAGAAATGGACTGATTTCACACTCCTCCAAACATCAGCGAGCTCATCA
Nfkb NM_214654.1 ENDOGENOUS CCTTGACCCTGTCATATCAGTGCCAGTCTTTGATAGCAAGGCACCCAACGCCACGACCCTCAAGATCTGTCGCATGGATAAGAGTGCAGGATGCTGTACA
Ngn XM_780649.2 ENDOGENOUS CTGACGAAGATTGAAACCCTTCGCTTCGCCCACAACTACATCTGGGCCCTGTCTCAGATGCTCAACATGGTGGACAGCAGCGAAAATGGTTGCCCAGGAA
Nk1 NM_001009577.1 ENDOGENOUS CCAGGATGAACGAATGTCGCCTGACTTCTCGATGGCTCATCACGGAGTCGACACAGCATCGCCGTTCTTTTCTCATCGGTCTCCGGGTCGGTTGCTAGCC
Nk2-2 nk22_742629.1 ENDOGENOUS ATCTACGACCAGAGTGACAATCCCTATACCAGATGGCTTCAAACTCAAGGGGGCGATGCAGTGCATTACTCATCTTTGGCACAGAACACCGTATCTCACA
Nk7 WHL22_567485_0.1 ENDOGENOUS CGTGGAGAAATCGGGTTATGAGAAGACGAAACACGACCCAACATCTTGCGACACTCATTTCTTGCTTAGCCATAAACAATCTAAACTGGGGCTAGACGAT
Nkx2.1 NM_214635.1 ENDOGENOUS CTTCGGCCAACAACCCGTATGCCCACATGCACGTCCCTCAGCTTTCCCACAACTATTGCAACGGATCGGTCGGGGAGCTTAGCCAGCACTACAGCGACCA
Nkx2.5 WHL22_680396_0.1 ENDOGENOUS ATGTCGTACATGCAGACCTTCGTGCCTCCTTTCACAACCGGTATGTTCCCGGGCAACCCGTCGTCGTTTTCGGTGAAAAGCATCTTGAATTTAGCGGAGC
Nkx3-2 GLEAN3_13047.1 ENDOGENOUS GGAGATGACGAGAGGTCGACGATCGCCATCTCATTGTTCATCACCGATATCATCAGGAATAGACCAGGATTCGAGATTCGACGACGATGTCCAATCGTCA
Nkx3.2 WHL22_339351_1.1 ENDOGENOUS TTCTTGCCTAATTCATACGGCTTGGCGCCTCAGCCTCCAGCGGTTAATAACACCATGGATTTAGGACCACCACCAGTGACCCGATTGGTACCGGATAATT
Nkx6-1 WHL22_567494_0.1 ENDOGENOUS TACTGGCCCGCAAATCTACTCCATTCACCCGTCTGGAGAGACAGTCATTTGACATGCCCGCCAGTGTCATCTTCGTCTCAGAGTTCCCATTGTTCAAGAG
Not WHL22_632281_0.1 ENDOGENOUS GCTACGGCAGCGACCGAGGTTCGACGCCGTCGCCGGATTCGTACAATTTCGTCTCTCCGAAGTCGAGCCCGCCTTCAAAGATTTGGAACGCGTCCCGTTT
Nr1h6 WHL22_41005_0.1 ENDOGENOUS CCCTCGTCCTGTAGGAAGCAAATGCGAATGCGGATGTATCATCCACAACAAGCCAACTCCCGAGAGTGAACCCGTTCCAGTCGTAGAAGTATCGTCATCG
Nr1h6b GLEAN3_15456.1 ENDOGENOUS GTTGAGGTGTGCCGAGAACTACGTTCCGGAGCGCAATGTAATCGTTGACGACATCACAGGCAGCGAATGGTCCTTCGAGTCCATGTTGTCATCAGGGTTT
Nr1h6c WHL22_609334_0.1 ENDOGENOUS CGCTGCTTACATACGGTTCGACATATACTCGGCTTACTCAGGCCCAGGAACAACTGATGTACACATTGGAAAAAGGATACAATGCCTCAACAGAAGTTCT
Nr1m1 WHL22_595573_0.1 ENDOGENOUS TGCTTACAGCAGGCTACCTATGTCTACTATCTCTAAGATGCTACGATCAGGACAACCTGTTATATTAATACCTAAAGATGTCTCCAGGGAAGGGAGGGAT
Nr1m2 WHL22_383507_0.1 ENDOGENOUS ATCGATGCATTATCTCCGTCTGGCGGAGTACACTCAACAGGTCAAAAGAGGAGCGATGACAAATGCTGGGTGTGTGGAGAGAAATCGAATACCTTCCATT
Nr1m3 WHL22_21036_0.1 ENDOGENOUS TTAGCATGCTTGGCTGTGACTACAGGTTCTGGGACGAGCTCTTTGACTTCTCCAGGAGCTTCAACAACCTCCAACTGATCAAGGAAGAAATTGCTCTCTT
Nr1m4 WHL22_175730_1.1 ENDOGENOUS CCTCATCGGCTGCTGGATCTCCTGAGACATTATCAGGACAGTCTATGCTTCCTCATCGTACAGGCTCTGGCAACAGAATAGATTTCCAGACGATAGCTTG
Nr1x WHL22_581390_0.1 ENDOGENOUS GGAACCAATGTCAATCATGTCGACTCAGGAAGTGCATCCTTATGGGCATGTCCAAAAATGCTGTTCGTTTTGGAAGGATGTCCAAACGAGAGAAGATGAA
Nr2C WHL22_96335_0.1 ENDOGENOUS GCGGACAGTCCAGAAACAGCTCTTGTATTCTTGCAGAGGACGTAGTAACATGGAAGGCTGCTGTGAAATCAACAAAACGAGTCGGAATAGCTGTCAGTTT
Nr2e6 WHL22_15174_0.1 ENDOGENOUS CAGAATGCAAACCTACAATGTTACAGGAGAAAGGCCATGATACTGAAATTCGTGAGGGACACATGAATGTTTCTCCACAGAATTGTGATGATACACCCAC
NtL WHL22_259272_0.1 ENDOGENOUS TGAATGCTATGCCCTACGACGATGATAACTTTGAGTCGCCATCGACATCACCACCTACATACGCCGAGCTCACACCCGCTGTCAATCACACTTTCAATCA
Nurr1 WHL22_220967_0.1 ENDOGENOUS CCCGAAACAAGACGCATCCTCACCGCCTTGTATTGTTCAAACGCCAGAAACCTTCTCATCAAACTATAGCAGTCAACCGGTTTGCACTACCGCCAGCAGC
Osr GLEAN3_24877.1 ENDOGENOUS ATAGCACCCTGCGGCGCCTAGTACTCAGCGGCTCCTCGTCAGTGCCATCATCGCGCCAGCACACATCATTGGGGTCTTCGTCGGGGGCACCGCCCAAGAA
Otp XM_001176278.1 ENDOGENOUS CCACCGTACTCGATTCACACCGGCCCAACTGAACGAACTGGAGAGAAACTTTGCCAAGACACACTATCCTGATATCTTCATGCGGGAGGAGATTGCGATG
Otx WHL22_532435_3.1 ENDOGENOUS CGACTGCGGCGACACCGGTCGATCACCGGTACCATCACACATGGAACCGCCAGGTGGGGCTAGGGTACCATACCCGATGCACCTTTACCCTTACCCGTAT
P3a2 WHL22_405480_0.1 ENDOGENOUS CCATAGCAACAGGGAAGAAACGCAAGAGACCGCATTCTTTTGAGACAAATCCTTCCATTCGGCGTCGCCAACAAACAAGATTGATCAGGAAGCTGAAAGC
Par1 WHL22_718026_2.1 ENDOGENOUS AGGTTCTAACTGTTCTTGATGTGCCTGAGTCGATTTCCTCTACAGACAACTCGGGGTCCAAAGTCACCTTGTATAAGATCAGCATGGAGTCCAATGATAT
Pax1-9 SPU_006683_1.1 ENDOGENOUS TCCTGGTTAAAGACCCATCAAAACTAAGCGCAAATTATCGCCAGCATGTCAGGTTTCGATTCGACGTGGTTGCCATGTTCGAAGGCTTTGGAGTGAATGC
Pax2/Pax2-5-8 XM_788689.1 ENDOGENOUS CTACCTGATGTCGTTCGCCAACGCATCGTCGATCTCGCACACAGCGGCGTCAGGCCGTGCGATATCTCAAGACAACTACGGGTTTCACATGGATGTGTTT
Pax4L/Hypp_886 XM_001200264.1 ENDOGENOUS AGGGACAAGTTCACTTCCCGTCGGTCCCTAGAGAGAACCAGTGTTATCCTACTAATAGCATGATAGTGGGGAATCCAGATCTTGAGACTCAATGGGCGGG
Pax6_1 WHL22_585512_0.1 ENDOGENOUS TTCACTGCTCAACAGATAGAGGAACTTGAGAAAGAATTTGAACGAACACATTACCCAGATGTCTTTGCACGAGAGAGGCTGGCACAGAAAATTGATCTAC
PaxB AF016886.1 ENDOGENOUS GACTCGTGATTCCTTTATCCGAGTCGGCAGGGTTGCACACATTGACACCTGTGCAGAGTGATACGAACGTAAGGGGCGCTTATACGCGAGTGGTTGAAAG
PaxC GLEAN3_00276.1 ENDOGENOUS CGATGCAGCTTCCGCACCTAATGCCACACCAATCGCTCTTACCTCATCCTGCGATCCCACATCCCGCCATGGTGCATCCAAGATTTGTTCTTCCAATCAG
Pbx/Pbx_1 WHL22_75202_0.1 ENDOGENOUS AAACGAAGAAACTTCAGCAAGCAAGCAACAGAGATCCTCAACGAATACTTCTACTCCCATCTTAGTAATCCATACCCAAGTGAAGAAGCAAAAGAAGAAC
Pdgfr/vegfrL WHL22_240520_0.1 ENDOGENOUS CAGCCGCTGACTCTCAAGGATCTTATCTGCTACTCATACCAGGTTGCTAGGGGCATGGAGTTCTTGACTTCTAAGAAGTGTATTCACCGTGACTTAGCAG
Pea XM_780608.2 ENDOGENOUS TGGAATGCGGCAGGGCGTTCTATGATGATGCAAGCGTACCGGAAAAGGCTCAAGAACAACACAATGAGCCGAGGCATGAGGTGGTGCGAGAAGGGCCTCT
Phb1 WHL22_302399_0.1 ENDOGENOUS ATGTTCCCAGATTGTGAAGCCGATAGACAAGGCTCTCCGTCAGCTGAATTCTTTGGAGATGTGATGAAACATGATAGAAGCAGCACAGGACGTTTACCTA
Phb2 WHL22_521451_0.1 ENDOGENOUS CGATATGGACGAAAGAGCGTCGCTGGACTCTTTCCGTGATGACCAACAGTCACCCTTGTCCGGTTCGTCGCCGCTTCACCCTCATCATCACAACGAAAAC
Phox2 WHL22_632079_2.1 ENDOGENOUS GACAACCTTTACCAGTGCACAGCTCAAAGAGCTCGAGAAAGCCTTTAATGAAACCCATTATCCGGACATCTATAAACGAGAGGAATTAGCCTTGAAGACT
Pitx1/Pitx1_1 WHL22_704986_1.1 ENDOGENOUS ATAAGGGACGATCCTGACGCCGTGATTTTGGATGATAACGGTGAGGAAATGAAAGATGGAAATTGTGAAAAATCGTGCAACGATCCCGACGCGGACGACG
Pitx2 XM_777251.1 ENDOGENOUS GGTGTGAAGGGTGGTCACGACGATGGCGACGATTCGGACAACGACCAGGACAACGGCAAGAAGAAGCGTACTCGTCGACAACGCACACATTTCACCAGCC
Pitx3/Pitx3_1 WHL22_11231_0.1 ENDOGENOUS CGATGACGAGTCAACCGATGTGCTTCAATCCGCCGACGACTATAAGCTCGACCTTCTCTGCAGCGACGCCCGTCAATGGCGTCGGCCAGCAACTGAACTC
Pknox WHL22_655290_0.1 ENDOGENOUS TTTGTCAACAGACTGAAGAGAGAGGGCAGCACATTCTTCATTGAAGATACAGAGATTGATACATTAATGATCAAAGCAATCCAAGTACTACGAATACACC
Pmar1b GLEAN3_14721.1 ENDOGENOUS GTTATCGACTTGGCCGTCATCGGTCGTAAGCGGAAGAGATCGTGCGACACCGTTGAGGTCGACCAGACCACACCACCTACCAAGAAGATGAATTCCGTTT
Pmar1c WHL22_462256_0.1 ENDOGENOUS CCACCGTCTTCACTGAGTTACAGCTACAGATTCTAGAGACGGCGTTCAACGACAACCAGTATCCTGATATCAATACTAGAGAACAACTTGCTTCAAGTCT
Pnr WHL22_485384_0.1 ENDOGENOUS CCAGAGATACGGGGAGTGAACCTTGTATGAAGCGTATATGTCCGGGTTTGACGTGCACAGTTTGCGGGGATATCTCGAGTGGCAAACACTACGGTATCTA
Pou4f2 WHL22_738139_0.1 ENDOGENOUS AGATAATCGAAATTCACCTGGTATCCTTGACAACGGAGACAAAAAACGAAAGCGAACGAGCATCGCTGCTCCTGAGAAACGTTCCCTTGAAGCATACTTT
Pou6/Hypp_2286 WHL22_701564_0.1 ENDOGENOUS ACAACATCTGTTCCTAGTTTAGTAACAACGCAGAATAGTCAAGCACTGCCCTCGCTTGCCACAGTAACGCAAGGTCTGATGCGTACCTCAGCAAATCATC
Ppar1 WHL22_46852_1.1 ENDOGENOUS AAGGTTTCTTCAGAAGAACACACAGAATGAAGCTAGTCTATAAACCATGTCCTTTCGTCAAGACAGAACCATGCAAGATCAACATAGCAACAAGGAATAA
Ppar2 WHL22_44643_0.1 ENDOGENOUS AATAGACACCGTCGAAACCACCGACGACTATTTCTTAGAAGTCAAGCCTGAAAATCACCCATTCGAAGTGGACAATGATGTCGAAGACATGGAGGCTTCT
Pric WHL22_636100_0.1 ENDOGENOUS CCCATACCTATCACCCTGTCAGCAAGTATTTGTAACCAGTGTGGTGGTGGGATCAGTGCGGGAGACATTGCTGTGTTTGCATCACGAGCCGGTCACAATG
Prox1 XM_776485.1 ENDOGENOUS TTTGTGCAGCGATACAGAATCACAAGATTCATTTGCGCAGGACAGAGTGGCGGAGGATCGCAGCAGTTTGCTTTATTCGGAAGAAGATATTGCGGAGAGC
Prx1 WHL22_486796_0.1 ENDOGENOUS TCATCACCATCATCATCAGCATCATAATGGTGGCCGAGGGTTCTCGGTGTCTCATCTTCTAAACCTGCAGGATGTAAGCGGGTTTGGCGATCACGGTCAC
Ptf1a GLEAN3_02677.1 ENDOGENOUS TACATCAATTTTCTGGCAGAGATGATCGAGAACGAGGGAGCTGACCTGGAGTCGCCAGCGACAAGTCCGGAAGAAAACCAGAAGAAAGTTATCATTTGCC
Pu1 WHL22_15960_1.1 ENDOGENOUS GTTATGGCTGGAAGGTATGTCACCGCGAGGTTACGACATCCAAAGACATCTACTAGATCTTGAGAGGTCCAAGCAAACAATGCTCGAACAATTGATTGAC
Rar WHL22_595420_0.1 ENDOGENOUS TTCCCGTTTCAACCCTCAAGATGCCAGTGTGACCTTCACCACTGGATTGACCCTAACTCAAGGTCAACTCAAGGCTGGTGGCTTTGGTAGTCTCCTTGAT
Rara WHL22_376236_0.1 ENDOGENOUS CTTGTATTCACTGGAGGACATCCCAGATGTAGACCTCACCTTCCCAGATGAAAGCTGTATTGATAGTTTCACTGATCCGTCCAACTCCCTTGGTGAGAGT
Rel GLEAN3_12203.1 ENDOGENOUS ATCGTCTGGTAGGGGATGGTTGCAGAGATGGTGTATGCACCAGAATGATTGATCCACAAAGACCAGAAGTAGTCTTTCATAAGATTGGAGTGCAGCGTAC
Reverb GLEAN3_17492.1 ENDOGENOUS TCAGATGAAGACGGAGCAGCTCATACTAAGCATCCATGAAGCACAGAAGAAGACCTTATGGGATTGGGGCATCCTGCAATGCAGGAGTTATAACCTTCTA
Rfx3/Rfx2 WHL22_19679_1.1 ENDOGENOUS CCTGCACAGACAACCATCATCGCAACACAGCCAGTCTCCTTTTACTCCATCCAGCCCACCTCGCACACCATCCAATCAAATCAACAGTTCCTGCAATTAG
Rhox3 WHL22_277630_0.1 ENDOGENOUS CCATGTCTCAGTGGTTAAAAAACGTACCTTCTCCGAGATGCTGGACGAGAGTTGTGTTGACGAGGGGAGGAAATCGTACTCGCCTCAGTCTCACAGAGTA
Riz WHL22_63053_1.1 ENDOGENOUS CAAAGAAGAGAACAAGGGTTGGACAAAAGTCTGTGAAAGCACCAAAATTAGAGGGAACTCCGCGTTCGATGGATGGAGATTTAGAGATTCCAGTCGATGA
Rora WHL22_499606_0.1 ENDOGENOUS CTGGCCCATAAAGCCGTGCCAAAGTCTTCCGGTGCAGTCTTACCAATTCGGTCCCACGCTTCCCTCCCGTCTTGGATTAAATCGGAAGAAAACAGGCCGA
Rreb1 GLEAN3_09642.1 ENDOGENOUS CACCATGTGTGGTAAGAAGCTGAGTTCTACCAGTTCCTTGGACCGCCACATGTTGATCCATTCTGGAGAGCGTCCCTTTACATGTCCTCTGTGCGCCATG
Rrm/P53L/Pink1L WHL22_747798_0.1 ENDOGENOUS AGCATGGTGCGCGAAACCAGGCATCTTTGGGTTGGAAATTTACCGGATAATATTCGAGAAGACAAAGTTATAGAGCAATTCAAACGGTATGGTCGCGTGG
Runt1/Runt1_1 NM_214614.2 ENDOGENOUS CCGGTACGGAGGAACAACCTACATAACAGTTATAAGATGGCCGAAGGGGGCCAGAGGAATAAGGCCTCATCCGTCTTCAAAGGAGGAGAACGGTCTATTG
Runt2 WHL22_425096_0.1 ENDOGENOUS CTAGACCAAGACGACCAAAGTCAAAGCATGATGATCCTCTGTGCTTCTCATCGATCATTGACACAGGCCACGCCCATTCTTATGGGTTGGTCATCTCTCA
Rx GLEAN3_14289.1 ENDOGENOUS GCACGCAGCAGCGGTCGCTGTCGCTGCAGCCGCCAGCCAAACAGCTATGTTTCCTTTGCTCAGCCCGACTCATCTCACATCGCCTCCTGGCCGCCCTGGG
Rxr WHL22_717794_2.1 ENDOGENOUS ATTATGGAGTCTACAGTTGTGAAGGTTGCAAAGGGTTCTTCAAGAGGACGGTACGGAAAGACCTCACGTATACCTGTCGGGACGATCGTAACTGTATGGT
Sage_1 WHL22_633149_0.1 ENDOGENOUS TATGGAAGACACACTGTTGCTAAAGCAGGAGCATGATGATGATGTCGTTTTACAACAAAGTCCTCTCGATGAAGACCAGTTAAACGGTCTTTCAGAGTCA
Satb1/Mib1_1/Hypp_2193 WHL22_589656_2.1 ENDOGENOUS CATCGTGCCATCAACGTTACAACTCAGAGATCTTGTCAGGGTAGCCTTATCCAAGCTGGATTACCCACCGGAAAGAGCGAAAAATGCAACAGGTGTTATT
Scl XM_787384.1 ENDOGENOUS ACCGGTGCTGGAGCGGGTAGGCTCGGGTAAAGTCGTACGCCGAATCTTCACCAATAGCCGAGAGCGATGGCGGCAGCAGAATGTTAACTCTGCATTTTCC
Scml1 WHL22_128919_0.1 ENDOGENOUS TGCTTCAGCCTCCTCTTGGTTTCAGAATGAATGCCTCATCGTGGCCCATGTTTCTACTGAGAACACTCAACAATGCCAGCATAGCTCCGACACAAGCATT
Scratch WHL22_758741_0.1 ENDOGENOUS CAGCCCTACCCTTCCTCATCATGGAGTAAGCGTCACCATCAACAATGGTTACATCCACGATATCACTCCATCGCCGTCTTCTCCTCCTAGTGAGCCCTTG
ScratchX GLEAN3_15640.1 ENDOGENOUS CATGTGGGACTGCTTTGCAGCAGAAACAGCCATCCAGAGTTACTATGGTTACTCCAGCGTTATTCAAATTCCATCGGCGAGGTCTGTTGTCTCAGTGCCC
Sfrp1/5 WHL22_146031_1.1 ENDOGENOUS CCTCAGCCTGTGTCAGAACATCGGATACACTCGTATGCGAATGCCGAATCTTCTGGAGCACGATTCCCTAGATGAGGTTAGAAACCAAGCTAAAAGTTGG
Shr2 XM_777791.2 ENDOGENOUS AGCACGCTAGCCAGCGTAGTCACATCCTTAGCCAATATGAACAAGAAGACGGAAGAAGGGCCAAGTCATTCACAACAGATCTATTCTCCATCTCAGACCC
Sim/Sim_1 WHL22_424996_0.1 ENDOGENOUS GAAGGTCTTGGTGATTCGTGGGGTAGCCGCAACATCTCGACTCTAGATCACATGACCAGGGAACTAGGCGCACATCTTTTGCAGACCCTTGATGGTTTTA
Six1/2 six12_742614.1 ENDOGENOUS GGTTGCCTGCGTCTGCGAGGTTCTCCAACAATCCGGCAACATCGAGAGACTTGGCCGTTTTCTCTGGTCGCTACCTGCCTGTGAGCATCTCCACAAGAAT
Six3 XM_776603.2 ENDOGENOUS AAAGAGAGAACGCGGAGTTTGCTCCGGGAGTGGTACCTCCAAGACCCTTATCCTAACCCTACCAAAAAACGTGAACTGGCTCAAGCCACAGGACTTACAC
Six4 WHL22_121462_0.1 ENDOGENOUS CAACGCTGGGATATCATTACCCGTGCCCACCAGCTTGCTATCGAATGTAGAGAACTTAACATGTAGTAAAAGCAAGGAAGTGGAATGCATGAACTCGCAA
Slc16a4L_5/Pric WHL22_635901_2.1 ENDOGENOUS GGTGCACTTGTGAGGCATTTTGGTGTTCGTTGTGTGATGATTGCTGGTGCCATCCTCTCTGCATCTGGCTTCTTGGCTGCTTCATATGCTCCCAACATTA
Smad_ip sip_742605.1 ENDOGENOUS CAGCGACACTGCAATCATCTATCCTGAACCTGTAGAAGACATGGACGGAGTCAATGGCGATACAGATGACCCTGATACTCCTGAAGGAAATGACAACGAA
Smad1/5/8_1/Smad1/5/8 WHL22_347626_0.1 ENDOGENOUS CTTCACCGATCCATCCAATAACCATGATCGCTTCTGCCTGGGTCTTCTCTCTAATGTCAACCGCAATTCCACCATAGAGAATACAAGGAGACACATCGGA
Smad2/3 GLEAN3_17642.1 ENDOGENOUS TGGATTCACTGACCCATCAAGCTCTGAAAGATTCTGTCTTGGTCTTCTCTCTAATGTCAATCGAGATCCTCAAGTTGAACAGACACGCAGACATATTGGT
Smad4 XM_001181042.1 ENDOGENOUS TGCATATCACTATGAGCGAATTGTGTCACCTGGTATTGATCTGACTGGGCTCACATTACAACACACAGCTGGCCCTCCACGTGTGGTTAAAGACGAGTTT
Smad5 GLEAN3_00739.1 ENDOGENOUS ACGCGTTGTTAGGGGGCGTGCCGCTCGCCTTCGTTTCACCATTCTTCGAGAACGAATACACCGGGACCTGGCCGATACGGCGTCATTCTTCAACGAGATT
Smad6/7/Smad6/7_1 WHL22_579194_0.1 ENDOGENOUS TTTATGTTGCCAGCTATTTCGTTGGCCAGAACTCAAGCATGGAAGCGAACTCAAACGGCTCAAATTTTGCTGCGAAATTAGCCAACAAGGCGACGAGGAA
Sna AY372519.1 ENDOGENOUS CCCGTCAACATTCCGCATCCAGTTATCCACAAACCCGAGCCTCTCCAGGCCATTCCCAACCCATCGGCCTACTGGCGACACCATCCGAATGTGATCTACA
Soxb1 NM_214474.1 ENDOGENOUS ATGATGCACCACGCACCGTCTGGCACCTCAGCCGCCAAGTCCGAACAAGCGTCGATGCCAACAGAGCGAACGCAGTCAGCAGCCACCGCCGTCTCCGCTG
Soxb2 NM_214473.1 ENDOGENOUS TGCCTTTATGGTTTGGTCAAGAGGACAGAGGAGGAAACTTGCTCAGGAAAACCCTAAAATGCACAACTCCGAAATCAGCAAGAGGTTAGGAGCCGAATGG
SoxC XM_792991.2 ENDOGENOUS GCTGCTAAGACCACCAGCAGCAAACCAAAAGCCAACAAGCCCAAGTCATCATCGAAATTGACGAAGATGAATGGCATCGTGATCGACCAGATGCACCCGC
SoxD1/Sox6L NM_214472.1 ENDOGENOUS ACTATGAGGAACAAGCCCGACTTGACAAAGCTCATCTGGAGAAATATCCGGACTACAAGTACAAGCCGCGCCCTAAGCGAACGTGCATCATCGACGGCAA
SoxE GLEAN3_16881.1 ENDOGENOUS GCTGGTGTCGATGTCCGTGACTTTGGTGGCGACATCATGGGCATGGAGGAGTTTTCATCGGAGGAGCTGGACCAGTACATCGTGCAGACCATAGCTAGTG
SoxF GLEAN3_14170.1 ENDOGENOUS ACAGTCCTGGCATGGTCATCAAGTCTGAACCAGGGGTATACGAGTTCCAGCAGCAGTGTGTGGTAGATAACGCTGAACTGACAAACCAAATGAATGTAAC
SoxH WHL22_173047_0.1 ENDOGENOUS ATGGCTAACGTTATGATGCCAGGACCACGAGAAAATATCAAAGATGCAAAAACACCAACTCAATCAAAGGTTCTAGTGCCTAAAGCTGTGACGATTACAA
Sp2/Sp2_1 WHL22_380228_0.1 ENDOGENOUS TGGTGGCCCGATGTACATTGAAGTTGGCCCTGGGGGAAATATTCCATCTTCGTCAGTGGGCGGAGCTACTCCAACTAAGTCGATTAATGCTGCTAATATT
Sp5 GLEAN3_24189.1 ENDOGENOUS AGTCTATGGCAAGACCTCGCATCTCAAAGCTCATCTGCGTTGGCACACAGGCGAGCGACCCTTCGTTTGCAACTGGCTTTTCTGCGGGAAGTCGTTCACG
Sp8/Sp8_1 WHL22_384609_0.1 ENDOGENOUS CCCGCATCTCTGTGGACATTCTGCTTATGAATCGTGGCTGAAAGCAGCAACTTCAGCGTCTATGTTATCGCGGGAGAACGGTGTTCATGGCTTCAGTCCT
Spalt XM_776283.2 ENDOGENOUS ACCAAGGAGCGTCCATTCCGCTGTGATTGCTGTAGCAAGGGATTCTCCACCAAGGGTAACCTCAAGCAGCACATGCTGACTCACAAAATCAGAGATATGC
Spz12 NM_214616.1 ENDOGENOUS GAGTGTCTTCATGGAGTGAGGCCCTACGAATGCAAAACTGCGGGAAACGGTTCGCCCAGAAGAGCTGTCTTACGCGTCACACCAAGATCCACACCGGAGA
Srebp WHL22_192617_0.1 ENDOGENOUS TCGGTAATGAATTCGGATCCACATCTAAATTCTGTGAAAAAAGAGGAGGATGAAGATGCTTTTCTTGATGACCTTGATCTGCAAGATGAGGACATGAGTT
Srf GLEAN3_27774.1 ENDOGENOUS GAAGCTGAAAAATGGTATCAGGGACCATGGATCATGTTTACCGGACAGTGACAGTAGCTCTGTTGGTACGGGCTCCGAGCTAGCGGACCGGGACCATGAC
Stat WHL22_738007_3.1 ENDOGENOUS CACTGGATAGAGGCACAGAACTGGAGTTCAATTGACATTGATAACCCAGTGTTTGAGCCTGATGCTATTGATCTACTTCATGGGATGATCAAACAGGTCC
Tbr WHL22_503644_0.1 ENDOGENOUS AGAAGAATTACAACACACGACTGATCAGGGTAATGAACACGTTGCTGCAACAAATCCAACTAAGTTTCAAAAGACGACGGAACCAGAGGAAAGCGATAAA
Tbx1 WHL22_21153_2.1 ENDOGENOUS GATTGTCACAAAAGCCGGCAGACGGATGTTTCCTACCTTTCAAGTGAAGATCTCTGGGATGGACCCTATGGCCGAATACATCCTTATGATGGACTTTGTT
Tbx2-3 GLEAN3_23386.1 ENDOGENOUS TCCATTCGCTAAAGGTTTCAGAGATACAGGGGCAGGGAAGAGAGAGAAAAGGAAATACATTGGCGCGACGGGCACATACGAAATCGACCACGGTGATGAC
Tbx20 WHL22_730224_0.1 ENDOGENOUS TCGTGCAATCGCATCACATCCTCCAACGCAATCATCTTCAGCGACAACAACAACATCATCATCATCATCTGCTTCCGCAACAACACAGCTTGGTATCACT
Tbx4 WHL22_625687_0.1 ENDOGENOUS TCAGAGCGAGCAAAAGCCTTTGCAATAGACTCCATTTTGTCATCGACTAAATCTAGTGCAAAATTAGAAATCGACGATGTGGACAGTGGAAAGCCAACAT
Tbx6/16/Tbx6/ XM_791917.2 ENDOGENOUS ACGGTTGCGATGCGAGGTTGTCTGATTATAACACGGGAAATGGAATGGTCGATACGTTATCGCCCTGTTACACGCAGGACGGTGTCATGGATGACAACGG
Tead4/ GLEAN3_21210.1 ENDOGENOUS TGAGATCTCGCGGTCGCCCATGTGTGAATACATGATCAACTTCATCCACAAACTCAAGCATCTCCCAGAGAAGTACATGATGAACAGTGTTCTAGAGAAC
Tel XM_791264.2 ENDOGENOUS CAGCGCATGTTCGAGAAACAACCCTTGCGACTTCCCGGCGGGAAAAACCTCCACGACAACTTCAGCGAGTCGGTGATGGATTCCTCTCAGGTTCCGCCGT
Tgif XM_775847.2 ENDOGENOUS AGCTCTACCTATCTCGCTTGGCTAACCTCACTCTTCTCCAGGTGTGCAATTGGTTCATCAACGCTCGAAGACGTATCCTGCCAGAGATGATTCGTCGCGA
Thrb/Thr WHL22_211956_1.1 ENDOGENOUS AAGCGAGGCAGAGAAGAAATGTTGAGACAGACTGGTCTAATTGCTAATAATCAGCTAACAGATCATGAAGAGGCTTTGATCAGAGCTATCTTAGTAGCTC
Tle1/Groucho WHL22_510742_1.1 ENDOGENOUS AACCTGGGCAGCCATTCAAATTCACAATTCCAGAGTCATGTGATCGAATCAAGGAAGAGTTCAGCTTCTTACAGGCACAGTATCATACGTTAAAAATGGA
Tll/Tll_1 GLEAN3_27487.1 ENDOGENOUS TTCATGAGTATCAGATGGGTGAAAAACGTTCCCGCCTTTATCGGCCTACCATACTCAGATCAGCTCACGTTACTGGAAGAGGGCTGGAGAGAGTTATTTA
Tlx3 WHL22_207227_0.1 ENDOGENOUS CCTCCTCTTAACCCGAGAGTTGAGCGACCACTAGCCTTCAGCATCGATCGGATACTTGGTCTCCCAGGTTATACATTCCAAACCAACAACCCACTTCATC
Trh WHL22_74366_0.1 ENDOGENOUS TGATGGGTTGTTCTGTCTTTGACTATGTGCATCCTGGAGATCATGCAGAGTTAGCTGAGCAGCTTGGAATGAAGCTACCACCCAATAAGACATCTTCATC
Tsc22d2 WHL22_509140_0.1 ENDOGENOUS GGCTAATAAACAAGATCCAGATCCAACGTCAGACACAGAGCAGAATGTTAATGTGGATATGACTAACCAGAGATCAGGCAGTAAAAAGAAAGCCTGTTTT
Tulp4L_1 GLEAN3_16617.1 ENDOGENOUS GGGTGGAACTCAGCCAGTAGAGAGTATCAGTGCTGTCAAGTTCTACGATACGACCGGACACCTTCGGTTTACACTTAACATTCCATCCCAGAGACCACTG
Tulp4L_2 WHL22_608861_0.1 ENDOGENOUS CACCATGGATTCCAACAATCACAACCTAGTTAGTGAGCTGACTCAACAGAATAATGCCGAAAGTCAAACCGTTGAGGAGGGAGAGACTGATTCGATTCCA
Twi WHL22_118674_0.1 ENDOGENOUS TCAGATAAACTGAGTAAGATACAGACTTTGAAGCTAGCATCGAGGTATATTGACTTTCTGTTCCAAGTTCTAAAGAGTGACGAGGAAGATCAAAAGATGG
Unc4-1/Unc4.1 XM_001203119.1 ENDOGENOUS AGCGAGATCGATTCAGAATGCATGGACAGTATGAGTATTGATACAACGGAGGAGCAGCGAAAACTCCCGGATTCGCCGCGCTTCAAGTTAGCGGCACGAA
Usf WHL22_467508_2.1 ENDOGENOUS TACTTGATCAGACACTAGACCAAGGACCACAAGACAAGGATAAAGATTTAGAAGAGGAGGTTACAGTACATCTAACAGCAGATGGAGATCAGGTTGTTCA
WHL22.290173.0 WHL22_290173_0.1 ENDOGENOUS GAATTCATCATCAACTCACGCCCTGATATCACTACTAGAGATCGGCTGTCACGCACACTCAAACTCAGTAACCTCTTGATTCATGTTTGGTTCCAGACCC
WHL22.767290.0 WHL22_767290_0.1 ENDOGENOUS TCCATGGAATGGCTGGGTCAACTGAATATACCAGCATCTTTGAATGGAAATTCTCCAAATGGTAAGAATGGACCTGGATCTACCAATTCGTTGGACCCAT
Whsc1/Trx WHL22_117840_0.1 ENDOGENOUS GCACACCTCCTGATCAGATGGGCACTCCTATAAAACAGAGTTCAGTTATTCCAACTCCGCCTTCTGATTCAGGACCCTTTGACACTTCAGAAGCGATGTC
Xbp1 WHL22_490709_0.1 ENDOGENOUS CGAGTCACCTGGGTCCGCAGCACTCATTTTTCCTCCGCAGCAGGAATCGACTCGACTCTTCCTCACCTTCCTGTCGACGTTGCTGATGTGGAGTCTGACG
Yyi WHL22_224218_0.1 ENDOGENOUS CCCAAAATGGCGGATGATCCGGACATCATTGACACCGAAATTGGATTACCAGTTCAAGAGGTGGAGATTGAGAGCATACCAATGGAACATATTGAGGGTA
Z111/Glis1_1 WHL22_242915_0.1 ENDOGENOUS TCGAAGAAGGTACCGAAAATGGATACAGGAGAAGATAAGAATTCTCGGATTCTTTCTCAGAAGTTAGGTGATGTCAATGCAGCAGATTTACCAGAAGGCC
Z13/Z474 WHL22_407274_0.1 ENDOGENOUS ATCAACCGTTGTTAACTGGCTGATTTCATCGTCGTCATCCTCGCCAACCTCAACGGCTCCACTTAGCGGTAGCATTAGCTACGGTCCCGTGCCTACGAAC
Z166/Rxr XM_788753.2 ENDOGENOUS GAGGTTCACGTGCGACGTTCCCACAGCGGTAAGCGTCCTTTCGCCTGTGACATTTGCCAAAAGACGTTCGGCCACGCGGTCAGTCTCAGTCAGCACCGCG
Zhangfei WHL22_126978_1.1 ENDOGENOUS ATGGTCGAGAGTGCTTTATCTCCGCCGTACGACGGGAGCGAATTTCAGGAGCTATTTCCTGAATTGACAGGCGTGGAACCAGAAGAAATGGTTGACATCG
Zic/Zic2 GLEAN3_28583.1 ENDOGENOUS CTCGGCAGCCGAGACCACCGCGCTCAGCTCGGGCTTATCTGATAGCACGGGGATGACGCTGAACATGAATTCCTACGGCATGGACACCTCTCATATGACG
POS_A(128) ERCC_00117.1 RNA TCAGGCCTTGCCCTTACTAATGGCGCGTTGTAACGGGCCTTGAGGGAATGTCACTATTGAGGCACCCGTTCGACCCTCAGAGATATACCATTCCGCCTAT
POS_B(32) ERCC_00112.1 RNA ATGAAAGCGCTGCTACTATGATAAGAGTACACGTACAGGTCTCGCCCGATTGGATTATGGCGAGCTGCCGCATTGACGGACATACCTTTGAACGTAATCG
POS_C(8) ERCC_00002.1 RNA GCCGCTTTCGCTCGGGTCTGCGGGTTATAGCTTTTCAGTCTCGACGGGCTAGCACACATCTGGTTGACTAGGCGCATAGTCGCCATTCACAGATTTGCTC
POS_D(2) ERCC_00092.1 RNA TACCTGGCATTTGGGCACTTCTTGCGTTTAAGCGGGAAAGATCGCGAGGGCCCGCTATTTGCGATACTTCCCATGTCGGTGCCGTCGCCTCTATGTACTC
POS_E(0.5) ERCC_00035.1 RNA GGTTGAATTTGAGCGGATGGGCTCAACTGCGTCGTAACCGGTAGATACAGGGCATACGAGCCTCCCTATTTAACGGCATCATCCCGCGTAGTGCTGGTCA
POS_F(0.125) ERCC_00034.1 RNA ACGAAGCTGTTCGGCCGCACGCAAGTACCTCCCACTTAGAAAGCGAATAACCCAACGACCGTGTTCAACCCTGGCCGTCTCTCAACCAGGTATGCAATCA
NEG_A(0) ERCC_00096.1 RNA AACCGCCGCATACGGCCGATTGTCGCAGCCCGGGTCGATTATAACAACGGTGCAATCTCAGCTAAACCGACGCAGTTTTGCTCCTTGGATTCTGAGCCCG
NEG_B(0) ERCC_00041.1 RNA GCACTGGCATTGGTCGTTTCAGGAGGCCATACAGAACTGGTTTATATGAAGGAACATGGATCATTTGAAGTCATTGGGGAAACCCTTGATGATGCGGCAG
NEG_C(0) ERCC_00019.1 RNA GTACAGGCTGCTGGCTCATGTTTCCTTCTACGCTGCACTTGCGGGCATAGAGGTCGGTTGCGATCTATATTCGGAGATAACTATTCACCCAGCGCCACTC