Nanostring

From EchinoWiki
Revision as of 21:20, 12 February 2020 by Echinobase (talk | contribs) (Created page with " == BARSI 2013 NANOSTRING CODESET == <br/> <br/> {| style="border:solid 1px black;padding: 2em; margin-left: 1em" class="sortable" ! GeneName ! Accession ! Comments ! TargetS...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

BARSI 2013 NANOSTRING CODESET



GeneName Accession Comments TargetSeq
Ac/Sc GLEAN3_28148.1 ENDOGENOUS GTCGCACGCCGTAACGAACGGGAGCGAAACCGCGTCAAACTCGTCAACCATGGATTCGCCAATTTACGCCAGCAGCTCCCTAACGGCGCCAATAATAAGA
Af9 WHL22_754828_0.1 ENDOGENOUS CAGAGGGAAGCTGCATAGAGCACTTTGTCGACAGAGTCGTATTCCAACTTCATGAGAGCTTTCCAAAGCCTAAGAGAGTTGTAAAGGACCCACCTTTTGA
Ahr_1/Ahr WHL22_676940_0.1 ENDOGENOUS AGCTACTTCCAAGATACACGTGACAAAGATCTCTTCCAGTCAGGCTCCTCCAACGGCCTAGCTCGCTTCCTTACTTGCGCCTCCTCCTCCTCTTCAAAGT
Alx1_1/Alx1 NM_214644.1 ENDOGENOUS AAGAAGAGGAGAAATAGGACGACGTTCACCAGCTATCAACTTGAGGAGATGGAGAAGGTATTTCAAAGAACGCACTATCCCGATGTGTACTGCAGAGAAC
Alx4 WHL22_731149_0.1 ENDOGENOUS CTAATGCCAAGAGGAAAAAGAGGAGGAACAGGACGACGTTTACTAGTTTCCAACTCGAGGAGATGGAGAAAGTCTTTCAAAAGACACATTACCCGGACGT
Ap2 WHL22_151633_4.1 ENDOGENOUS ACGGGTCTTCATCCTATGGACGATGGCTCGATACCCACGGATGAACGTTTCTCAAGGTTAGCCCAGGGAGACTATTTCACGAATATGAGGGCGCTTTTCC
Ap4/Tcfap4L WHL22_28828_0.1 ENDOGENOUS ATGGCATTCTATGCATTGAAATCGGAGAAAGATACAATTGGCGGATCCTTGCGAGTTCCCAGCGATATGATAAGTCCGAGGGGAAGTCCGTCTCCACCAG
Arnt/ArntL GLEAN3_00129.1 ENDOGENOUS CAAGCCAAAAGTCGAGACTGGGTGTGGCTTCGAACCAGCTGCTTCAGCTTTCAGAATCCTTACACCGATGAAGTGGAGTACATCGTCTGCACCAATACAG
Arxl WHL22_134213_0.1 ENDOGENOUS GCATGCGAGGATTCACCATATTCGGAGCTTACATACGGAGGTGATTTGGACGAGACTTTTGCGAGAAGGAAGCAGCGAAGAAACAGAACCACATTTACTG
Ash1 WHL22_755846_0.1 ENDOGENOUS CTACAGCTTCAGTTTGACCATAGTCATGCTGCCCATGGAGATGAACCTGTCCAGGTGTCCCTTGCCGATGTTGATGCGGTCGTCAATGCTGATGTCGGTA
Ash2 WHL22_96450_4.1 ENDOGENOUS GAGGGCGACACGTTAGGATTCTTCATTCAGCTTCCAGAGAAGACAGAGAAGGATCCAATCATCCCTCCGACCTACAAGGACAGAGCCCTGATTAAATTTA
Ash3L WHL22_523564_0.1 ENDOGENOUS CCCGTACCGAACTACCTCGACCCTCGCTACGCTAGCTCCTTCATCAGCCACTACGGGCATAGCTACGTCCCACTCCCGAACCCATTCGGATTCTACGATC
Atbf1 GLEAN3_17348.1 ENDOGENOUS CGGCGATCAGGGAGGACAAGGTTTACAGACTACCAGATTAAAGTTCTACAGGAGTTTTTCGAAAGCAATGCCTACCCTAAAGATGATGACCTCGACCACC
Atf2 GLEAN3_26905.1 ENDOGENOUS GATATATGTTCATAAGAGGCAGCGTGTTTCGGAGGAGGACGATAACGAGAATAAACGACAAAAGTTCCTGGAGAGGAATCGAGCTGCTGCTAGTCGGTGT
Atf6b WHL22_176487_0.1 ENDOGENOUS GGGGATCCTGGGTTCTACAATGGAAATCATGTACGAGATTTATCAGAAGATTTAAATGTTGCTGAAGAAATGGCCTTTAATTCTGGACTGGATGAAGAGG
Atl7L WHL22_523571_0.1 ENDOGENOUS GGCGGAAGAAATGGACCTGAGTCGGGTCAGTTTGACAATTCCCAAGAATTCAACCACCAGGGGAGTGCTAATTTGCAGTCTGAAATATCCCAAAATAGAA
Ato WHL22_459901_0.1 ENDOGENOUS GCGAGATGGTGAAAATGGAAGTGGATCTGGTAGAGATTAAATCCGAAATCATAGACCACGGTGATAGCGATAGTCATGGGAAAGATCCGGAAGACCATTT
Awh WHL22_9369_0.1 ENDOGENOUS GCGCTGGGTGTGGAAAGGCAATTATTGATCGTTACTTGTTGAGGATAGGGCGTGGTCTGAGCTGGCACTCATCCTGTCTTCGATGCCTTGAGTGTGATGA
Barh1 WHL22_299123_0.1 ENDOGENOUS TCGCGAATTCGACAGACGATCAGCATTCCACTTCAGGCACTCTGATCTCTCGTTACAGCGAGCTGAAAAAGACAATAAGGACATTGATGACGATGTCGAT
Barx/Barx_1 WHL22_133111_0.1 ENDOGENOUS TTTGCATTCGTCATCGCGACCTTCGTCACCACCGCAACAGAGATGTTTGCCATCGCCGGAACTTCGGCGGAAAAGTTCTCCGGATAACGCTATCAGTCCA
Bbx WHL22_356734_3.1 ENDOGENOUS CCAAAGAGCAGTGACTTCAAGAGCCCTTTGAAGAAGTTGAAGGAGAATCTGTTAGGGAAGCACTCTTCATCCTCCTCCTCATCGACGACTATCACTAATG
Birc6/Birc6_1 WHL22_609255_0.1 ENDOGENOUS CTCCAGTGACCTCTTCTCGACCATTCTGCTCACCAGGGACAAGTGTATTCCTGTTGTCCAGGGGCTAGTAAGACTTTTGCTGGCTATGGATTTCACCTGC
Blimp1 WHL22_5073_1.1 ENDOGENOUS AAGATGCCAACAAGAAATACTTTTGGAGGATTTACAATGGCCAGAAGTTCGTCCACTACATTGACGGTTTCAACAAGAAGCGAAGCAACTGGATGCAGTA
Bmal WHL22_117405_0.1 ENDOGENOUS GTGCACTGTAATGGGTATACCTAGCGTCTCAACGAACCTGTCTGGGTTTGGTTTGTTCATGGGTGAACACGTAGCTGATCCTACCTCCTATGGCATCTAC
Bra_1/Bra WHL22_600041_0.1 ENDOGENOUS AAAAGCTTTCCTGGATATCAAAGACAATAGAAACGACGGACATGATCTCTTCGATGATGTGCACGATTTCCAGGGTTCAAAGTATCCACAATTTGGAGGC
Brn1-2-4 XM_777816.2 ENDOGENOUS GGGTGTTCTGGGACCAGGTGGTGGTCAGTTACCTAGTCATAATGGTTCCGAAACGGTGATCGAAGACGATGCACCGTCATCGGATGATCTCGAGCAGTTT
BsxL WHL22_497248_1.1 ENDOGENOUS CGTTGAAATAACCAAGAAGACCTGCAGATCGCCATCGCCTCCATCTCAAGATAGGAAGAAATTGAAGAGGAATTTCTCAGATAAGTCTGATGGGGAGGAG
Cdxl/Cdx XM_001182111.1 ENDOGENOUS ACAGCATTCATCAAGCCCTCATCATACCACAGTCGACACCAAACCCAAACTCCCGATCATAACAACGATGACCACGGTCTCCGGCGATGTCATCAAGACG
Cebpa GLEAN3_01657.1 ENDOGENOUS TCTATTGATATTGACGCGTACTTAGCTTTAGGGAGGGCTGAGGTACAGCAGAACAATCACGTTGATAATACTGGTGACGGAATTCTCCGACAGCTAGAAC
Cebpg WHL22_744360_0.1 ENDOGENOUS CACCACTTTTGGGCTGTTCAATGCCAACCCAAGGTTGGGGTCCAGTTCTCCTAACCCAGCTCTGTCGCGGCGCATTGTCCTCAAAACTGAATCTCTCACT
Chx10 WHL22_249523_0.1 ENDOGENOUS CTGGTCATCAACGATCATCGTTCGCTATCCATGAACTCCTGGGGCTTGGTCGTCAAGAGCAGCAGAAATCTCGGGAATTCATCCCATCACGACCGCTCAT
Cic WHL22_183787_0.1 ENDOGENOUS TAGCTCCAAACAGGCCATCGTCTACTCCGGCCAACTTTAACCAATCATTGCCAACATCTGTCATCGTTGCAAGAACGACGGATATCCAAAGCAATGTCCA
Clock WHL22_335679_0.1 ENDOGENOUS ATGAACTACGGAAAGAGGTCTTCCTTACCGAAGACCAACAGAAAAATATGTGATATGTATGATGATGGTGAAGATAGTAAAGATACCACAAAGAGGAAAT
Couptf1 WHL22_647845_1.1 ENDOGENOUS GTTGCAAGAGTTTCTTCAAAAGGAGCGTCCGGCGTAACCTCACCTACTCGTGTCGTGCTAATCGGAATTGTCCTATTGATCAACACCACCGGAATCAATG
Cp2 WHL22_553348_0.1 ENDOGENOUS TGGACTTGCTGAAGATTTTGCATCGAATTTGTCGGGTTTGGGAACTGAGCTTGGCACGGGAGCCTACAACATGAGTGAGGTGTTAGCTTTGCCTATGTTC
Creb/ WHL22_278056_0.1 ENDOGENOUS CCCTCAATCAAGTGGTTCACGTCCAGTCTGTCATTCAAACTAACAACCAGCACTCCGTCATTCAGGCTACTCCTGTAGTTCAAGTTCAGCAGTTGGATGA
Creb3l1/Tcp11 WHL22_19719_0.1 ENDOGENOUS CTGAGCTCTCAGCTCTCCAAGCTACAGTCGATCGTCAACAAGATCTCCAAACCAATCAAAGCTCACACAACTCAGACCGGTACTTGCCTCATGGTTTTAG
Creb3l3 WHL22_743120_0.1 ENDOGENOUS TGTCTACCTCAGAGGACTTGGACCTCTTGTTCGATGGCAGAGATCCGATTCTCTCGGACGAAATGATCTTCAGTCTGGATATCATCCAAGACAGTCAAGA
Ctcf WHL22_295495_0.1 ENDOGENOUS CAACAACAGGTGCTAATGGTAGCCATGCAAGACAATGGTCAGTTATCATCTATGGATCAAGGTGTGGCCCAGATTGCTTTCTCAGGAGCACCAGTCAATA
Cutl/Cutl1cl WHL22_223192_0.1 ENDOGENOUS CCCTGTTGAAGAGCTTTCAGGCTGAAGTGGATTCCTTGTCTAAACGAAGCAAAGCAGCAGAAGGAGCCTTCCTCTCAATTTACAAGAAACTCATCGATAC
Dach1/Dac dach_742644.1 ENDOGENOUS GCGGACTACACACGGTTTACACAAAACTGAAGAGACTGAGCATCACTCCGGTGGTTTGTAACGTAGAACAGGTTCGCATCCTGCGGGGACTTGGGGCGAT
Dlx XM_777652.1 ENDOGENOUS TGACTGGGATGGGTGCGATGAGTCAGACGAGGCACTACGGCTATCACTTTATGAACTCTTCCCTAGCCGGGCACCCTCCGATATACGACCATTCTGATCA
Dmrt GLEAN3_28120.1 ENDOGENOUS TTTCTCGCACAGACCGCCAAATCCTTTCCAAGCAGACGCCCTCCTCGGTCGGACCTCAATCTTCGCACCTTCCAGTCTGAGTGACCTTCATGTTGGTGCA
DmrtA2 WHL22_114846_0.1 ENDOGENOUS AGAGAATGAAGCGAAGGAACTTGGACTTTATTACGAGACTTCAGATGGTGCTATCTACGCGATGAATGGGATTGCTGTCCAGACACACAAGGGTTATGAT
Dmtf WHL22_529855_1.1 ENDOGENOUS AGGGTTTTCATCTTAGCGCACCTACTGACATTCCAGTATCAGGAAGCTCCCATGTGATGGGGATAACTTGTGTGCAACGAACTAAAGAGTCAGAGCCTTA
Dp1 WHL22_476402_0.1 ENDOGENOUS TAGTTTAACTAGCTTGTGGGGTCCTGAGGGTCAGGGTAGCCCATTAAAGACTCAACCATCGACGCCTTCAAAGTCATCGGGAAAAGATATCGTTGGTGAC
Dr WHL22_544154_0.1 ENDOGENOUS ATGGAATCACTTTATACCGCGGCAACAAAACATATGTCACCGAGGCATCTTGCTATGTTTGAGATGTCACGAAGAGAGATCCTCGAGAAATATATCCATC
E12 XM_001185037.1 ENDOGENOUS GCCAACAATGCAAGGGAGCGCATCCGCGTTCGGGACATCAACGAAGCATTCAAAGAACTGGGTAGGATGTGCCAGTTACACCTCAAGCAGGATAAGGCCC
E2f3 e2f3_742630.1 ENDOGENOUS CAGAATGGTTTGGACGACGACTTTGTTGCGCTCTCGCCACCGGCTGTGGACGACTACCTCTTTGCCTTGAACGACAACGAAGGCATCTCTGACCTGTTCG
E2f4 GLEAN3_28827.1 ENDOGENOUS GCCACTGAGTAGACATGAAAAGAGCCTCGGTTTGCTCACTACGAAATTCGTTGGTCTACTTCAAGAAGCACCAGATGGAGTATTAGATCTTAAGCAAGCG
E78 WHL22_454455_1.1 ENDOGENOUS CAAGTCTTCAGGATTCCACTACGGCGTCTTAGCCTGTGAAGGATGCAAAGGCTTCTTCAGGAGAAGCAGCAAAAGAGAAAAGGAGTACACATGTCGTCAT
E78a WHL22_454662_1.1 ENDOGENOUS CCGTATGACGTGTTTGTATACACCATCCAGTGCACCGTTTCTCAGGGGCTTCACGTTTCCTCAGGAAAATCAAAACTCTCACTTTCCGAGCGAAGACATG
Ebf3 WHL22_113329_0.1 ENDOGENOUS GTAACTTCTTCCATTTCGTGATCGCGCTCTACGACCGAGCAGGTCAACCCATCGAAGTCGAGAGGACATCCTTCGTTGATTTCATCGAAAAAGAAAGGGA
Egr GLEAN3_15358.1 ENDOGENOUS AGTTTGATCAACGAAGCGGTATCGGCTCAGCCTATCGTATCCTGCGAGACGGCTTGTTTCACACCTAGCTGCACCTCAAGCTTTCAGATCGCCAGCACTC
ElfA WHL22_629740_0.1 ENDOGENOUS GGGGATCCTTTCAAAGGTCGACGGGCAGAGGCTGGTATACAAATTTTGTGAGATACCAAAGAATATCCGTGAAATCGACTGCAGTTGAGGTATTTTGGAC
ElfB/ElfA GLEAN3_20123.1 ENDOGENOUS TTGATTTCAGCATGGGGCCATCAGATAAAACTTACCAGTCTTCCAGTAGTCCAGCAGTCATTGTCCAGATCAACGATGTCTTGCTTACACCAAGCGAGCT
Elk NM_214627.2 ENDOGENOUS ATCGTGAGAAATTCCAGTGGACGACGTCCTTACGCAGAGAAGGCGATGAGATGTTCTCAAGACCACCCGTGACAGTGAATGTTCAGGAGGTCTACATCAC
Emx XM_777915.2 ENDOGENOUS GGCACGGCGGCATCATCAAGCCTATGCCCACAGAGGCATCCTTCTTTAACACTCTCAGTGGAATGAAGGGACTCTACCACCCTGAGCCCATCTATCACAC
Engrailed WHL22_521432_0.1 ENDOGENOUS CTAGGCGGCCGCGAGCCGCGATCACCGACACCACACCATCACCCTCTCCATGTCCCTCGGTCCCACTCTGACAATGACCTCGCTGTCAAGACACGCTTCA
Enz1/Enz2 WHL22_223228_0.1 ENDOGENOUS CGGAGTGTGAGCGAAAAGAGTGAAAAGAACACCTTTACGGATCTCAAGTCTATAGTGAAGTCTGAGTACATGAGCTTGGTGGCTAACAGACGCTTCAAGA
Eph WHL22_110632_4.1 ENDOGENOUS CCAAGACGAGACCGGCCATGATTGTGACGGAATTCATGGAAAACGGTTCACTAGACAAATACTTGAGGGAAAATGACGGACGATTTACAGTGACCCAACT
Ephrin WHL22_763086_0.1 ENDOGENOUS TTCTGGCCAAGTCCGATGGCTTTGCCCAAGGCAAAATCAGGAATCATATTTTTTGTGAACGCTGTTCTTCTTCTGTGGAGCGTCACACTGGCGAAAACAC
Erf XM_788779.1 ENDOGENOUS GCGCTTCACCTACAAATTCAACTTCAGCAAGCTGATTCTAGTGAACTACCCGGGAACCGACCTCAAATATGTGCCTCCGTTCATCCCGCAATCTCGGGGT
Erg NM_214668.1 ENDOGENOUS TGTATAGGAAGCATTATCGGTAGTCTCGGACGACCAGACGCTATTTGAGAACACATACCGTGAGGTGAATAAGTCCAACACTATCGTCTCGTCGCCACAC
Err WHL22_91797_0.1 ENDOGENOUS CTCGCTGGTAGCAAAGGCGTTACATCTCACAAGAAAACTCAGGGACATTGGCATTGACAAGGAAGAGTACGCTCTGCTCAAATGCATCATACTATGTAAT
Ese ese_742603.1 ENDOGENOUS TCCGGGACCTTCTCAAGTCCGAATCCTACTGCCCGAAGTTTATCCGATGGGAGGATCGGGAAGCCGGAGTTTTCCGATTCGTCAACTCGGAAGCGGTCGC
Ets1/2/ WHL22_238821_1.1 ENDOGENOUS CTCTGATGAATGCATGCCTCAGAGAAAGCTTTAGCAGCTTCAAGAAGGAACAAGAAAGGCTTGGAATCCCAAAAGATCCGTCTCGATGGTCCGAATGTCA
Ets4 NM_214534.1 ENDOGENOUS TGTCCAGAAGTGGTTGTTATGCGTCGCCAATCGCTTTGAGCTAGGGGAACTCGAGATGGGCCACTTTTACATCAATGGACCAACCCTTGCAACACTCCAG
Eve NM_214651.1 ENDOGENOUS CCGACGCCTACTCACTCCACCTCCGATCGCGAGCAGAGCTTCTACATGGTCTCGGTGCACACCCTTACGCAAGACCGTTTCCAAACCCTGCTGCCGCTCC
Evi1 WHL22_227650_0.1 ENDOGENOUS ATGGAAAGGTTTACTACAAAGCCATTCATAACATAGGTACAGGTGAGGAGCTATTGGTACTCAAGGATGCAGCCTTTCCTGATCAAGAAGGCAACCCAAT
Eyg WHL22_568711_0.1 ENDOGENOUS CATGCTGCCATGTAATTCACGGGCCTGCGATCTCACTCACCCTCTACTTTCAATACCACAAGGTTACTCCGGTAAACTATTTGGCCGCCTATACGAACCA
Fn3f_67/Fgfr WHL22_323968_0.1 ENDOGENOUS TGCGATATTATGTGTAATATGCAGTTGGACGTTATCAACGGCTGGAGCAACTACAATACGAGATAAAGAAGTAAAACCAGATGCTCCTCAGAATCTAACA
Fog WHL22_591129_0.1 ENDOGENOUS CGACCATTGGACCCTTCTCTGCGAGGATTGAATTGGTGCAAGAGGAATGTGTCCGGGAGAATTCGATCTGTGTGAGGGGTTCAAGCAAAGCTCTATTTAG
Fos WHL22_538480_0.1 ENDOGENOUS CTACCCAGGATCATACAGACACCGTCTTCCATCGTTCACGGAGAGCGATTCCCAGTCGTCGACTCGCGACACGTTGTCGGACGATACAGCGTCACAGTCG
FoxA WHL22_439762_0.1 ENDOGENOUS CATCCAGCCAGTATGCTAGGAGTAGGACAACATCCATCCTTCGCACATTCACATCCATTCTCCATCAACAGTATAATCTCACCTGAACATAAACTGGACA
FoxABL WHL22_615153_0.1 ENDOGENOUS TATGAACGTCTTATTTCTGACTCTCACCACCGCTATCACAGTACAGAGATAACTGGAATATACGACAACGACAGCGGTTGTGATTACCGCATCAAATATG
FoxB NM_214632.1 ENDOGENOUS ACAGTGATGCCAAGCCGCCATATTCCTACATCTCCCTAACGGCTATGGCTATCCAGAGCTCGCAGGAGAAGATGCTACCCTTGAGTGATATCTATAAATT
FoxC DQ286740.1 ENDOGENOUS ATCAAGGAATGGCGATGCAACCTTATCATTCAGCGGCTCCTTCCATACCTGGCGTCATGCATTCGGTGTTTCCACCAGAACAGGGCTACTATCGGCACCC
FoxD/FoxD_1 DQ286738.1 ENDOGENOUS AAGAGGCAGCAACCAGACTTTTTCAGGGAAGCGGGGCATTTCATGACGGGTCCATATCCTATGGGGCGACCAGCATACGGTTATGCGATGGCAGGACTTC
FoxF DQ286741.1 ENDOGENOUS TATGATCGGTGGCCCGATGTCGCCACACCTTGCGAACAGCGCACCGAACGCCTGCTCGCCCAACGGTGGATTCATGACTAGCTGCTCGATGGCGGGTGGG
FoxG WHL22_389872_0.1 ENDOGENOUS CCCATCTCCATCATCCTGTCATGACCAAGATACATGAGCCCATTATTAGAATGGAGTCGCCTCCCTCCAATCAGACTTCCATCACTGAATCCGAGAGTTT
FoxI XM_001181648.1 ENDOGENOUS GAATGCAGCCGCCGCATCGACTTTAAATAGTGAGGTTCCTGCATCCCATCTCTCTCCCAACGATATAGCTCATAGCAACATGGCAGCTCTGAGGTACTTC
FoxJ1 WHL22_468365_0.1 ENDOGENOUS CATCACAATCACCACCATCTTCATCAGAGTCCCATCCAACTGGACCAAAAGATAGACTACAAGACGAACTCGAGCATTAAGCCTCCGTACTCTTACTCGA
FoxJ2_1 WHL22_767230_0.1 ENDOGENOUS GCAGTCGCAGCAACAACCTCTACAACTGTCATTAGGAAATACAGATTGGATGAATAACCTTGACATTCTCAAAGAAAGTGTGCGGGTTGCAAGCAGCTAC
FoxK DQ286748.1 ENDOGENOUS GTCAGAGGCTAAACTAATGGATCAAGCTTACAGAAGAAGACGCCAAAGGGGAGTGCCGTGCTTCAGGACACCCTTTAGCGGGGTCTCATCAAGCCGCTCC
FoxL1 WHL22_639477_0.1 ENDOGENOUS CCCAATAATCAGATTAACAGTTCAAATGACGTAACCAAGCAGAACGACAAGGATAACGAGGAGGAGAATGAACCCAGTAAAGACTCTTCGGATACAATTA
FoxL2 WHL22_159450_0.1 ENDOGENOUS GCTCGTACTCCCAGTTTACACCGTGCACGCTCTCGCCTTCGCCTAACACGGGATATATTTCGTCGGTTGGGTTGTCGCAGAACTCGGCGATCTCTAGCGC
FoxM/FoxM_1 XM_001200365.1 ENDOGENOUS AATGCTTTGCTCCTGAAGGCTCCTTTGACATGGCTGCGATGGCAAATCTTCAAATGCAAGCTCTGGTCGGCGATCCTAGCAGAATGCCCATGTTATCAGC
FoxN1/4 WHL22_604594_1.1 ENDOGENOUS ATCAGTCAATGATGTGTTTGCGAATGAAGTTCAGAGTGAAGTGAACGAGATTTTGAGGTCTGATGCTGCCCGATTTTCGCCGCAGTCCTCGATGGATCTC
FoxN2/3 XM_790403.2 ENDOGENOUS ATGATCCAATGGACCCGCACCGACACATCAATAGCAAACCTCCTTTCTCATTTAGCTGCCTCATATTCATGTCGATAGAGGACTGCCCTCTTAAGCGTCT
FoxO/FoxO_1 WHL22_241099_0.1 ENDOGENOUS TCTCAGTCCTGCCGTCCTGGCTGAGGAACCGCTTGATATTAAACCAGTTTTACCTTTAGAAGGCGGAGAAAACCGTGAATTATCAACACCATCTTCACAG
FoxP WHL22_621648_0.1 ENDOGENOUS ATGAAACCTCTCAAAATGGCAGCCAAAATTCTTCGAAATGCGACGTCCATGATCTACAGGAGGACATCTCTTGCGAGTTTCAGTGGACAGACTAGTGTTG
FoxQ1 WHL22_145751_0.1 ENDOGENOUS CGAGACCGTGATTTGGTGCCCAGCCGAAGACGTTATCGAGTCTCACGGTGATGACGAATTAATGACGAATACGTCGACATCGTCGTCGTCAAGAAAAGGC
FoxQ2 NM_001079550.1 ENDOGENOUS CATTTCTGGGCAATCCATCCCGCTAACCTTGAAGACTTCGCCCGTGGTGATTACAGGAGACGGCAAGCTCGTCGCCGAGCACGATCAGTCAGTTATTCTC
FoxY WHL22_399521_1.1 ENDOGENOUS TCCACCACGGAATGGAAAGAAACCATCGCGGGTCGATCTCCCGGGTTTTACCTACGCTGAGCTGATCACCATGGCGATTCAGTCGTCGCCTTCTCGTATG
Fra2 WHL22_538597_1.1 ENDOGENOUS GTACCCAACGATCAATATGCCTGCCGATGATGGTATTCAAGATCTGTTGACTACTATGGCGTCTGGTTGTATGCCCGCTACCAGTGAGGATTATACCGCG
Frizz WHL22_45238_0.1 ENDOGENOUS CTGCGAAGCCATAACAATCCCGCTATGCGAGGATATGCCGTATAATATGACGATCATGCCAAATCTTCTGAACCATCAGCACCAAGAGGATGCAGGGTTA
Frizz5/8 WHL22_42488_0.1 ENDOGENOUS ATGCTACTTCATGGTCGCACTCGGCTTCATCATCCGTCTCGTCGTCGGTCACGAGCAGGTAGCATGTTCAGGTCAATATGTTCGTGTAGGATCGACGGGT
Frizz9/10 WHL22_60681_0.1 ENDOGENOUS TTCGTGTTTTCTTGATGTGGGGTTGGTGTTGTGGCAGCTATGGGCTTGGTGTGCGTCATGGAAACACACAGGGACATTGCGAAAGGATCACCATTGATTT
FtzF WHL22_765708_1.1 ENDOGENOUS TGAATCGTGAGGAGACAGGCGTTAAAATTTCGAATTACAGGGATTACAACGCGTATCATCGCTACAATATGCCGATGTTACCCGACCATGCCGAGTACTT
Fxr GLEAN3_11348.1 ENDOGENOUS TGGAGATACCAGGTCCTGAGGACCTCAAGAGAGTTACGCCATGGAAAGAGGGCCAGAACTCGGGGCAAGACTCTAGCGATGACAACGGGCCCAAATCGGT
Gabp WHL22_120896_2.1 ENDOGENOUS CAAGAACAAGAAAGCAAAGGTGGAATCAATCAACTTAGCCTCTCAGAATGTCATAACTCAGATGATGGATATTGCCCAACCTCTATCTACTTTGAAGAAG
GataC WHL22_660411_0.1 ENDOGENOUS CTGGTGCTTGGTGTGGTGGTCCATTTGGTAGTTCAGCACCTCATCCCGGTCCAACAAGTTCCTACACGTTACCGGCATCGACGCCGATCCAGCCGAGTTC
Gatae/GataL NM_001005725.1 ENDOGENOUS ACCTCTCATCAAAAACCCAAGGAGATTGCAGTCTGGCTCAAGACGAGAAGGAATTACATGTGCTAACTGTCACACTAGCACTACAACACTGTGGCGTAGG
Gcm NM_214661.1 ENDOGENOUS GTTCGGGAGAAATCGTGACTGTTCGGCCAGCCACTTCGGATCGTGCTCGGAAGAAGCAAGGCGATAAGAAATGCCCAAGGACCGGTTGCGATGGCAAACT
Gcnf1/Gcnf1_1 WHL22_765489_0.1 ENDOGENOUS CTCTTTGAACTCCTCTGCAAGCTCATGGACCGGATGCTTCATCACCAGATCCAGTGGACCAAACGGTTGCCGTTCCAGTCCAAGATCCCGATCTCCGATT
Giant WHL22_668554_0.1 ENDOGENOUS ATGGAATCTAAGGAGGTCATCGAAGTTAAAATGACAAAGCCAGAGAAATCCGACTCATTTGAAGTCATCACTCCAGTTAAACCAGAGAAGATGAAGAAAT
Glass2 WHL22_204563_0.1 ENDOGENOUS CTCAGCGCCTACAACACCGGCCCACAACCTATGAAAAACCTTTCACTTTATCCTGAAAGTGATTTCACGAGACCTCAGACGAATCACATGACCACACTTC
GliA GLEAN3_17627.1 ENDOGENOUS GCTTACTCTCGACTTGAGAACCTCAAGACTCATCTTCGATCCCATACCGGTGAGAGACCGTATGTCTGTGAGTTCCAGGGATGTACCAAAGCCTTCTCTA
GlisB WHL22_583631_0.1 ENDOGENOUS CATTCTGCAAGGTCTTGGACTTCTGCGTGGGGGTCGAAGAAACGATCATTGTCCATTTCTCCACTCTCTTCAGAAGGCATGGACTTGAACTCTCTCATTC
GlisC WHL22_66475_1.1 ENDOGENOUS CAGCACATGACGTCCATCAGTGGAAAAGACGGCATGATAAATCTAAGCAATATTTCTTCCTGCAAGTCAAGTGGTTCCATAGGGTACACAAGGACCATAT
Grf WHL22_274118_2.1 ENDOGENOUS AATAAACTTTCACCTCTAAGTGATGTCAGCAACAACAACGAAGAAGATCCCTCGGTCTTGAAGCTTCCACCCTCCAAGAGATGGAGAGGAACATTTCACA
Gsc NM_214498.1 ENDOGENOUS GTTCAAGAACCGCCGAGCTAAGTGGAGGAAGCAGAAACGGGAGCAACAAGAGGCTGCCAAACGGGCTTCCGAAGCATATAAAACCGAGTACGGGTCCAAA
Gsx WHL22_585269_0.1 ENDOGENOUS CACCTCTAACTCCAACCAACGGTACTGATCATCCTCGGACACCAGTTTCGATTCATCATCATTCCAGGACATCACCAGATACCAAATCGGCCACTATCTT
Hairy WHL22_143140_0.1 ENDOGENOUS GACGTCGAGCTCGTATTAATGACAGTCTTCTACAGCTGAAGAATCTGGTTCTCGATGCTCTCAATAAAAACAATCCTCGTCATTCCAAATTGGAGAAGGC
Hairy2/4 NM_001001768.1 ENDOGENOUS GCTGTCAACAACACATCGCAGGTCACGCAACCGATACGCGTTCAGATCTCGCAGGCGACCTCAACGGCGTTAAGTTCATCAAACGGCATCGTGACATCAC
Hb9 WHL22_107381_0.1 ENDOGENOUS CATGGGGTACGGAGCGGCCACCCGCTATCTTCTTTCTCTGTCGACTGGTTTCGTAACGGCGTCATGCTGCCCAGATTCGGAGACTTTGCAGGAGGTTTTG
Hbn XM_775964.2 ENDOGENOUS AGGCGCAGCAGCGGCTCACGACGGCGCCAAGCTCTCCCATTCCCTTCCAATCTCCATCCCGAAACTCTACATGTCGCCTGCCGAGAAAGGAAGGAGAATG
Hes GLEAN3_21608.1 ENDOGENOUS GCAACATCGCCAGTCCAGCAGTTTGCTACAACACCAAACGGCATGGTTCTCCTCCTCCCAGCCCACACCGTCCAACACAACTCGGTCATCTCGGTTCGAG
Hey WHL22_578435_1.1 ENDOGENOUS CTATCAGTTGGTCACTGGGACATGAAAAGGACAATGAGTGAATCAGAAAGTGACGAATTATTTGACGAGACCATGAAAGGATCACCGAGCCAATCATGCC
Hey4 GLEAN3_15712.1 ENDOGENOUS ACCCACCAGACCCAAACACTCAAGTGCAATTTAGGTCGGGGTTCAACGAGTGCATGGCAACCGTCACCCAGTTTCTTTCGGCAAATAATGGCTCGCTGAA
Hhex hex_742618.1 ENDOGENOUS CACGTTCCCGGGGCATTCGTTCGGACCGTCGCCGTACGGACAGCCTCAGCATCCGACCGGAGCTTACTACGATCCCGCCGCCTTACCTGGTGGGCTGGCT
Hlf XM_001175813.1 ENDOGENOUS GTGCACCTTTACCGCGGAGGAGCTCAAGCCGCAGCCTATGATCAAGAAGTCACGAAAGATCTACGTGCCCGATGAGCAGAAGGACGACAAGTACTGGGAG
Hlx GLEAN3_14802.1 ENDOGENOUS TTTTCCAGCAGCAGACTTTGACGCTAAGCGCGGAATAATTAATCCCTCGCGACATGGAGACGACTTAAAATCCCAAATTACCGTGGTGATGCAAGCTCAA
Hmbox1-2/Hmbox1 WHL22_285632_0.1 ENDOGENOUS CAGAGGTGGTGTTGATGACTTCCACGTAACCAATGAGGAAGTAGAATCTCTCTTCAGGAAAGGTCACATGAACGTGAAAGAAGACATCAAGGATTTCCTG
Hmg2 XM_001176404.1 ENDOGENOUS GTACAGGATCGGCGCAGTAAAGCTGAAGGGCAAGTGAATTTCACCGCTTTCTCTAAGGAATGTGCTGATAGATGGAAGCATATGGATGATGGAGACAAGC
Hmx GLEAN3_12490.1 ENDOGENOUS CGATGTCGCCATCCAGTCCGTCGATGTCCAGCAATGGGTACAGTGAAGGGCCCATATACGGCTCCACTCGACACCCACTATCGGCGACCGTTCCGGGCTT
Hnf1 XM_001201193.1 ENDOGENOUS GAGAAGTGGTAGATTCCACAGGTCTCAACCAATCACATCTCTCGCAGCATTTGAATAAGGGCACGCCCATGAAGGGCATTAAACGAGCCGCTCTCTACAA
Hnf1aL WHL22_520179_0.1 ENDOGENOUS CTTGGGCATCGTACTCATCAACCCTCATCCACAATGCAAGCTCTTCAGCAACATCAGCAACAACAACAGTCAACCTTGCATCGCATGATGAGAAACAATC
Hnf4 GLEAN3_21192.1 ENDOGENOUS TGCGTGGTGGACAAGGACAAGAGGAACCAATGCAGATACTGCAGGTTAAAGAAGTGCTTCAGGGCTGGCATGAAGAAAGAAGCTGTTCAGAATGAGCGGG
Hnf6 NM_214659.1 ENDOGENOUS ACCTGATACCCATTCGTCTTCAGTAGCACCCGGCTTAAACCCGGGCGATTTCTTTAACGCCACGGATTTCGCGGTGAGTCGCCACTCCAGACCCGGTGGA
Hox1 WHL22_630296_0.1 ENDOGENOUS GCCATCTCGTATCGGGCATCGGAGTTCAAAGCACCACTAACTCGTACTCACACCTTGGTGATAGTCGACATCGACTTCACGATTACAACCCGCCATCGAC
Hox11/13a WHL22_629879_1.1 ENDOGENOUS GGCGAGGGAGGAGAACGAGAGGAAAAACCATTCGCATCATCCCGCCGGACAACATCACCCACAACACCATCATCATCTCGAGTCGAAGGGCGGTGACCAC
Hox11/13b NM_214609.1 ENDOGENOUS AACGCCGTCCATACTCCAAGTTACAGATCTACGAACTAGAGAAGGAGTTCACAACTAACATGTACTTGACCCGAGATCGTCGCTCGAAGCTCTCACAGGC
Hox3 WHL22_630100_0.1 ENDOGENOUS CGAGCCGTTTCTCTTCGGTTTCCACCCGGGTAGCTCGCACCACTCCGACAGGTCATTTCGCGGGGCGCCAGCCTACTGTCAATTCTCCTACTCGTGTACA
Hox5 WHL22_502907_2.1 ENDOGENOUS ATGCTGCTTTCTACACTGCTCGTCTTCTGTCTGGTGTCATTCAGCCGGGCCACTGGCCCAGTGGTAATGACTAGTAAAGGACTCGTCAAAGGATTCGTTG
Hox6 WHL22_629690_0.1 ENDOGENOUS ACCAAAACTCACAACACTTTTCCCAAAGCAACCTCGACAGTACTTTCCCATTTTTCATGCCTCACCAGTTTTACCCTCACCACACGTCCGACTCGTACCC
Hox7/Hox7_1 NM_214560.1 ENDOGENOUS CGAGGATGGCCGCCACGTATAATTCAGCGTCGTGGGGCAGCACGGCGGCGGAGTTAGGGGACGGGAGCTACCGGGGTAGAGTGAGCGCACTGACTGCTGG
Hox8 WHL22_629711_0.1 ENDOGENOUS TGAGCTCAATGTTTTTGAACTCACTATTCACCAAATATCAACCGGGTGAAGCGTGGTTTCCCAGTGGCTTCGATCCCGCGGCGAGCGTTGCCAGCAGAAA
Hox9/10 WHL22_629725_0.1 ENDOGENOUS TGACGTCATCAGATGCATGAATAATATAAGATGCAACATGCTTAAAGGGGTGGGAGGGCGGCGGTGCAAACTCTGGATAATTGTTGGATCACATTTAGTG
Hypp_142_1 WHL22_755982_0.1 ENDOGENOUS CCTGTATCAAGTTGGGAAGACACCAGAAGTATACTACGCATCTCGTTGAAGATGGGAGCAACTCTATAAACACAGCAGCTCATCCATCTTTGTGGACAAA
Hypp_142_2 WHL22_755991_0.1 ENDOGENOUS AGGCCCAGCCTCAAGGCTCCAAGAGCCCGCTACCAACAGGGTCATAGTCGCTCGGACTATCAGCAAGCCCTTACCATCCAGTTCCACTCCGTCCTCATCG
Hypp_1837/Oct1-2 WHL22_67463_1.1 ENDOGENOUS AAGATGACGATCAAAGGACAGGTGTCCTCATCATGAGCACTGAGACAGCAGAAAACTCTCCTGCGAAGAAAAGTAAGGAGGTTGTGATGATACAAGCAGG
Hypp_2032/Ovo GLEAN3_12448.1 ENDOGENOUS ATACTGCTACAAGCAGCGCCGTTCCAAGATATTTGTCTGTGAGGAATGCGGCATCACGACCGAAACCGCCGATTTTCACTACGACCACATCAAGGAGATA
Hypp_2213/Apa WHL22_771305_0.1 ENDOGENOUS GTTCTTTACAGTCCAGGCATTGAATGTACACAGCAGGATTCACACTGGGACCAAACCTTTCAAGTGCACTCACGATGGCTGCGATAAGAGCTTCACTACG
Hypp_2792/Gbx GLEAN3_25492.1 ENDOGENOUS TTGCTGGCTCTGGAAAAGGAATTCATCGGCAAAAAGTATCTGACGCTGAGCGAACGCGCACACATCGCACGCTTTCTGCAATTGAGCGAGGTCCAGGTTA
Ia1 WHL22_769122_0.1 ENDOGENOUS ATGCCGCGTAATTTTCTTGTGAAACGGACCAAGAGAACTGGCAGCGTGACGTACAGACAGAGAACTTCTGACGAAGAGTATGATGATCTTGGCTTTGTTG
Id XM_775662.2 ENDOGENOUS ACGCGCCGGAGTCTCGAACTTCACCATGTCCGATTGCTACGAGAAACTGAAGCAACTTGTGCCGACAATCCCGAAGAACAGGAAAGTCACACGAGTGGAG
Irf WHL22_263123_1.1 ENDOGENOUS ATGCAGGAATACAACACAACGAGGACCGATCGTTTTCCGGCGACTCCTAACGAAATGCCTGGATTGATTATGACACATGTACCGTCAGATCTGTCCCGAC
Irf4 GLEAN3_26877.1 ENDOGENOUS CCCGCGAGTACATCGGCAAGATCCTGGATTGTTGCGATAAAGGATTGTCCTTGACATGCCGTGATGGTTGTATCTATGTGAAGCGTCACTGCCGCAGTGT
IrxA irxa_742615.1 ENDOGENOUS AGGTCCTAAGGATTCTGAACACGGCGCACTTAGGGATGATTACCGAAGAAGAAGTGGAGAATTGTTAGCTGAACACCACCGACTGAGCGGATTGAATGGC
IrxB WHL22_496846_0.1 ENDOGENOUS ACATTGAGAAGTCATGCGACCAGGATCATGTGGATACGAATGAAAAGACAGCAGGAAGAATAGATTTGTGTCAAACACATAACTTGAGGATGAAGGCTCG
Isl/ WHL22_143854_0.1 ENDOGENOUS GGAATAAGATCTACCACATAGACTGTTTTCGTTGCGTGGCTTGCAGCAGGCAACTCATTCCCGGGGACGAGTTTGCGCTCAGGGAAGACGGTCTATTCTG
Jun GLEAN3_03102.1 ENDOGENOUS AAAACCAGGAGCGCATCAAGGCTGAGAGGAAAAGGCTCAGGAATCGAATCGCCGCCAGCAAGTGCCGCAAGCGCAAGCTTGAGCGTATTGCCAGGTTAGA
Klf11 WHL22_59256_0.1 ENDOGENOUS CTGACTTCGACGCCGTTCAGACTCTCTTGTCTATGAGGAGCGTTCCTTCTCAAGTCACCATCAAACGGAGCGATTCTCCCGTGCCGTCGTCGTCATCGCC
Klf13 XM_777064.2 ENDOGENOUS TCACATCTTAAAGCTCATCTCAGAACACACACAGGAGAGCGACCATTCCCGTGTAACTGGCAGGACTGTAACAAGCGTTTTGCGCGGTCTGACGAGCTTG
Klf15 WHL22_441254_0.1 ENDOGENOUS GGATTCAAACAGTACCAGCTCAATGTCCGACATCGACATGAGTGAACATTCCAGCCCTCTCAGCTCCAACAGCGATGATGATTTGTTTCTCGATTACCTC
Klf2/4 XM_776508.2 ENDOGENOUS GGGAAACCACTGCGACTTTTCATACGAGATTTGGCCTGATATGGAGAGCTTTCTTCAGGAGATCTGTCCGCCAAACAGCTTTGAGGAGCCATCATTTGCC
Klf3/8/12 GLEAN3_17470.1 ENDOGENOUS TCTGACGAACTCACCAGACACTATCGCAAGCATACGGGTGACAAGCCATTCAAATGTACTCACTGTGACAGGGCGTTCTCAAGATCGGACCATCTCTCGC
Klf7 XM_787725.2 ENDOGENOUS AACAGAAAATTACAAGGCGGCGAGAATGATATCTGAAGCGACCCTCACGCCACCATCATCACCTGAACTTGGTCGTAGCCGCTTAGTGAGTGTGCCTGTT
Krl/Z474_1 WHL22_335235_0.1 ENDOGENOUS TCGTCGATCATCCGTTGTCAACTGGCTGGTTTCGTCGTCGTCGTCACCGTCAACGGCTCAACCTAGCGGTGGCGTTAGCTGCGGTCCAGTGCGTAAGAAC
L3mbt WHL22_447114_2.1 ENDOGENOUS CGGTATGAAGTTAGAGTGTGTTGACAAGAGGAATGCGTCTCTCATCAGAGCTGCTACCATCACAGAAGTAGAGGACTACAGGATGCTGATTCACTTTGAT
L3mbt_1 WHL22_727178_0.1 ENDOGENOUS CGTTCACAACACTTATAATAGCTCAGCAGAGGAAGAAGTAAGCAACGATTTTCCTGAAGAACAAATGATGCCTTCAAGTAATCTGTACAGTCTATACCTG
L3mbt_2 WHL22_727184_0.1 ENDOGENOUS GAAGATAACCGAACTGCATCTGACAAAGTCTCTGCATTGGATAGACTGTTGGCTAAGTCTGTCGATGATAGCGTTTCGGTGAGAGTAGCTCCTTATACTG
Lass6 WHL22_41285_4.1 ENDOGENOUS ACCATGGTTCTGGGACCTTAGACTATGCTGGCAGCATTTTCCATTCCATCCGGTGACAACAGAGATCTACAACTACTACATGATCGAGATGTCTTTCTAT
Lbx WHL22_489358_0.1 ENDOGENOUS ATGGAAACGATGGCGGGGACGAACACGATAAGATGAGCGTTCATTACGTTGATTCGGACAACGAGGAAGACACGAGCATGTCGATCTCCAAATTGTCTCC
Ldb2 WHL22_386521_1.1 ENDOGENOUS CAGTCAGCCCGACTACAGAATATATGATCTCAACAAAAGGTTACAACAGAGAACAGAGGAAAGTGATAATCTCTGGTGGGATGCCTTTGCCACAGAATTT
Lef1/Tcf NM_214475.2 ENDOGENOUS TCAACACCCAAGAAGTGTAGAGCGAGGTTTGGTGTGGACCAACAAGATTTCTGGTGTAAACCTTGCAGGAGGAAGAAGAAGTGCATACGATACATCTCAT
Lhx3-4 WHL22_691261_1.1 ENDOGENOUS ATGAAACAGGACTTGTTTATCGGAGGACCTCTCCAGATTGAGCGAAACATGCCACAGGCGACCAACGATTCATTTCAAGAACAGAAATCCATCTCACTGT
Lim1 WHL22_720614_0.1 ENDOGENOUS GAACGGCCCATCTTAGATCGTTTCTTGCTCAACGTACTGGATAGACCCTGGCATGTCAAATGTGTCCAGTGCTGTGAATGCAAGGCTAAACTCACTGAAA
Limc1/Lhx2 lhx29_742607.1 ENDOGENOUS CACTACGAAACCCTCTTCGTTCCGTCCTCCGATCAGAGCACCTATCACCATCTCCACCACGCCTCGCCTCCTCCTCCGCAACCAACCCTCCATAATCTCT
Lmo2t WHL22_43544_0.1 ENDOGENOUS CTCAACGTGAATCCTTCGTACCTGGAGTGCCACGGATGCAAAGAGTCTATCAAGGACCGCTACTTCTTAAGAGCCATTGAGAAGTATTGGCATGAAGACT
Lmo4 GLEAN3_19586.1 ENDOGENOUS TGGATCGATTCTGGCACACGGGGTGTCTCAAGTGTTCCTGCTGCAACGTTCAACTCGGTGACATAGGACACTCATGTTTCTCGAAGGGAGGGATGATTCT
Lmpt WHL22_543989_3.1 ENDOGENOUS ATAATATTAAGAAGAGGCAGAATTCCGCCTTTGAAGAGGTGGATAAAGGGCAGCCCTGTTTGAGCTGTGGAGATAAGTGCCTAGGATTTGTGCCACATAA
Lmx1 GLEAN3_14157.1 ENDOGENOUS ACCTCATGAAAGTAATGGATCACTGCTGGCACGAGCAATGTCTTCAATGCAGCGTCTGTAGAATAAGACTATCACACTCCTGCTTTGCCAGAGATCGCAA
Lox NM_214650.2 ENDOGENOUS ATGGAAGGGAACAATCCCGCGTACTATCACTACATCCCTAAGGGACAATTCCCGATACCTATCACCACGGGTGAAGTTAGCAGCTTTCCCTCTAGCTATA
Lztf1/Lztf1_1 WHL22_224817_1.1 ENDOGENOUS GACGTGGAGGGCAAAATGAGTGCTCTTAAATCTCAAATGGAGCAGAATATGAAGCTGACCACCGATAGAGCAAATACAATGGAAGGAGACCTTATTTCTT
Mad mad_742627.1 ENDOGENOUS ATCTGAAGGTTTTACCTCGCACAAAGACCAGCTATGCAGAGAACAGCGCTTCCTCAGAAGGAGATTGGATTACTTACAGTCTACCTTGCACAGACAACGT
Maf WHL22_652540_0.1 ENDOGENOUS GGCGGAGTCCGCCGACGGTTGCGGTACCTTCAATGATGTCGATGCTTTAGCTATGGAATATATCAGAAACTTTGACTTGAGCCTCTGGCAGCTTGGGGCA
Max max_742599.1 ENDOGENOUS TTGGAGAGATCTTCGACAGGGGAAGTAGCCAAGACCAACGGCATCATTCTCAACACCAAATTATCTCACTACGACGCCGGTTCCGAATCCGACTCGAACT
Mbx1 GLEAN3_11297.1 ENDOGENOUS TAGAAGATGATTTGGACGACGGTTGTCGAAGGCACCCGACGACGGACTTTAGTCGCGAACATTTTCACGCAGCGATGATCTCTCCGCGTTCCGACGGCGT
Mef2 XM_790894.2 ENDOGENOUS TGAGTCCTACATCCTAACGCCACGCACTGAAGCCAAATACCAGAAGATCAATGAGGAATTTGACAGAATGATGAATGGTGGAAGTGGGCAACCCATGAGC
Meis WHL22_2236_1.1 ENDOGENOUS ACGCTCAACCTCACATGAACCACGCACCATCCGTCGCTCATCCACAATTTTACCCTGGACATACACCTTCAAATGTCATTACTCCATCGGTCACACAAAG
Mist_1/Mist WHL22_490847_0.1 ENDOGENOUS CGAGACTCTGACTCTAGCCAAGAATTATATTTTAGCACTGTCTGACATGGTAGTAGGACTCAAAGCAGACCTTGATCGTTTATCCACTGAACACGGGATC
Mitf XM_777978.2 ENDOGENOUS CAGGTCAAGACAGAACCGTTGGCTTACCCTGAAGAACATGTCCGAGCCCATGCCAAAGAGCGACAGAAGAAGGATAACCACAATATGATTGAGCGAAGGA
Mll3 WHL22_653011_1.1 ENDOGENOUS GTTATGGGGGTAGTCTGATGGATGAGAACCAGTATGACGATGATGTGATGGATTGTAATAATGGCAGTGATCCGAGCTGTTCCCTCTGCTGTTGTGGTGA
Mll4L/Trx2/Mll1L WHL22_568858_2.1 ENDOGENOUS AGATATGGACGATCACTGGTGCGATATCTTCCAGAAAAAGATAGAAATCGTCAGCATGCATTCTTTGCACGTACAGCAGCCATCCAGAGAAATTTGAAGT
Mlx XM_788213.2 ENDOGENOUS GCTAGTTTTGCAGAGCTTTCGGCATGTGTATTCAGCTGGCTAGAGGAGTACTGCAAGCCTCAGACACTCCGAGAACTGGTTGCTGAAGTCTTGAGGAAAG
Mlx/Ip WHL22_419504_0.1 ENDOGENOUS CCGTCGAGTGAGACCATACATTCGGGTCATTTTATGGTCAGCAACCCGCACAAAGTGAAAAAGAGCGGCGGCTACAATTTTGACGATGCGACCAAGGAAA
Mnt WHL22_677195_0.1 ENDOGENOUS CAAAGATAAAAGGGCTGGAATCAGAGAAGTACATAATAAACTGGAGAAAAACAGACGGGCGCATCTGAAGGATTGCTTCGAAAACTTAAGAAATACTGTT
Mox_1/Mox WHL22_737621_0.1 ENDOGENOUS CATAGTGTCGAACCACAGTACGGATAGCGCGTGCGGTTTGGACAACGGTTCAGACGCGAGTAATTACGGCGGTTCGGATAATGGGGATCCAAATAGTCCG
Msx NM_214613.1 ENDOGENOUS CTCGCTCTCGAGCGCAAATTCCGCCAAAAGCAGTACCTCTCGATAGCCGAGCGTGCAGAGTTCTCCGCCTCGCTCAACCTCACCGAAACTCAGGTCAAGA
Msxl WHL22_404908_0.1 ENDOGENOUS TGGCTCTCTTAAATTCTGCTTATTCGCTCCAGCAGGGGTTCTACGCCGCCGGGGTCTTCCCGGCGCCACTATCTAACTATTCGGGCTTTTCTTTAGTCGG
Mta1_1/Mta1 WHL22_580176_1.1 ENDOGENOUS GCAGTGCAGGCTCTGTGCAACTTGCTGGGTGTACTGGAAGAAATGTGGTGGACTTAAGATGCCCACTAGACTGGATGGGGAACGTCCTGGTAACCTTAGG
Myb XM_792258.2 ENDOGENOUS ATGGCCCTAAGCGTTGGTCTCTCATCAGCAAGTTTCTGGTGGGGCGCACAGGCAAGCAGTGCAGGGAGAGATGGCATAATCATCTGAATCCTGATATAAA
Myc WHL22_687558_0.1 ENDOGENOUS CCCTCTCTTTGCGGACTCTGACAAACTCCAACGCGTACTCTCTGAGATTCTTGAAGACGAACCGGTATGGATGACACAGAGTTTAACATTTGTTGGTCCC
MyoD WHL22_295720_0.1 ENDOGENOUS TAGTCCAGGGTCATATTCATCAGACAAAGCACAGCAATACGGAGATGGTTATGACGTTTCGTCACCCTACGGTTACAATGGTTGCGGGAATGCTTCAAGT
MyoD3 WHL22_531810_0.1 ENDOGENOUS CCGATGACAACCAACTATACCGAGATCACTTCGACATCAATGACGACCGAACCTCGACATCGCTGAACTCGCTTGACCAGTGGGACAGAAACATATTTTT
Myor2 GLEAN3_12008.1 ENDOGENOUS CTCGGATGCGAGTGTTAAGCAAAGCCTTCTCCAAGCTGAAGACGAGTCTGCCGTGGGTTCCGCCAGATACGAAGCTCTCTAAACTAGATACACTTCGACT
Myor4 WHL22_49654_0.1 ENDOGENOUS CATCATCGGTTGAAGGCCCAAGGATATCTTCATCCGGTCAAGAAATGGCCAATGCGATCCCGTCTCTACGCCGGAGCTTCAGCGGACCGTCTCTTAGATA
Ncsl WHL22_131182_0.1 ENDOGENOUS AACGGCGAAATACCGAACTGCGCACGCGACGCGGGAGCGGATACGTGTCGAGGCTTTCAACGTGGCCTTTACGGAGCTGAGGAAATTGCTGCCGACGCTG
NeuroD1 WHL22_694980_1.1 ENDOGENOUS TCGAGACTCTACGCCTCGCAAAGAATTACATCCATGCTCTAGCTGACATTCTCAGGACAGGTGTCGTTCCCGACAACATCTCATTCGCGCAGACATTATC
Nfat WHL22_538507_3.1 ENDOGENOUS ATGCTGAATGAAGATTCTGAATGTGGAGACCTTATAGTAGCTGGTGAGGTAAGTGGAGTGGATGATTTGGACCATGGGTATGACACAAACTCTGATTTGT
Nfe2 XM_001187612.1 ENDOGENOUS AAAGAAGTCAATGAGATGCAGCAGAGGTATGCAGAACTCTGTGAAGAAGTCTTTGCCTCGGTTCAGGATGAGCATGGTAGCCCAGTTGATCCCAATGACT
Nfia WHL22_579762_0.1 ENDOGENOUS CTTGGTCATGGTGGTACTCTTCAAAGCGATTCCGCTGGAGAGTACGGACGGGGAAAGGCTGGTCAAGTCGCCCAATTGTACGAACCATACATTATGTGTA
NfIL3 WHL22_733532_0.1 ENDOGENOUS TGGAGAACGACATCATAATGCTCGAGAACAATGCATCCAAGAGTGAAATTCAGAGAAATGGACTGATTTCACACTCCTCCAAACATCAGCGAGCTCATCA
Nfkb NM_214654.1 ENDOGENOUS CCTTGACCCTGTCATATCAGTGCCAGTCTTTGATAGCAAGGCACCCAACGCCACGACCCTCAAGATCTGTCGCATGGATAAGAGTGCAGGATGCTGTACA
Ngn XM_780649.2 ENDOGENOUS CTGACGAAGATTGAAACCCTTCGCTTCGCCCACAACTACATCTGGGCCCTGTCTCAGATGCTCAACATGGTGGACAGCAGCGAAAATGGTTGCCCAGGAA
Nk1 NM_001009577.1 ENDOGENOUS CCAGGATGAACGAATGTCGCCTGACTTCTCGATGGCTCATCACGGAGTCGACACAGCATCGCCGTTCTTTTCTCATCGGTCTCCGGGTCGGTTGCTAGCC
Nk2-2 nk22_742629.1 ENDOGENOUS ATCTACGACCAGAGTGACAATCCCTATACCAGATGGCTTCAAACTCAAGGGGGCGATGCAGTGCATTACTCATCTTTGGCACAGAACACCGTATCTCACA
Nk7 WHL22_567485_0.1 ENDOGENOUS CGTGGAGAAATCGGGTTATGAGAAGACGAAACACGACCCAACATCTTGCGACACTCATTTCTTGCTTAGCCATAAACAATCTAAACTGGGGCTAGACGAT
Nkx2.1 NM_214635.1 ENDOGENOUS CTTCGGCCAACAACCCGTATGCCCACATGCACGTCCCTCAGCTTTCCCACAACTATTGCAACGGATCGGTCGGGGAGCTTAGCCAGCACTACAGCGACCA
Nkx2.5 WHL22_680396_0.1 ENDOGENOUS ATGTCGTACATGCAGACCTTCGTGCCTCCTTTCACAACCGGTATGTTCCCGGGCAACCCGTCGTCGTTTTCGGTGAAAAGCATCTTGAATTTAGCGGAGC
Nkx3-2 GLEAN3_13047.1 ENDOGENOUS GGAGATGACGAGAGGTCGACGATCGCCATCTCATTGTTCATCACCGATATCATCAGGAATAGACCAGGATTCGAGATTCGACGACGATGTCCAATCGTCA
Nkx3.2 WHL22_339351_1.1 ENDOGENOUS TTCTTGCCTAATTCATACGGCTTGGCGCCTCAGCCTCCAGCGGTTAATAACACCATGGATTTAGGACCACCACCAGTGACCCGATTGGTACCGGATAATT
Nkx6-1 WHL22_567494_0.1 ENDOGENOUS TACTGGCCCGCAAATCTACTCCATTCACCCGTCTGGAGAGACAGTCATTTGACATGCCCGCCAGTGTCATCTTCGTCTCAGAGTTCCCATTGTTCAAGAG
Not WHL22_632281_0.1 ENDOGENOUS GCTACGGCAGCGACCGAGGTTCGACGCCGTCGCCGGATTCGTACAATTTCGTCTCTCCGAAGTCGAGCCCGCCTTCAAAGATTTGGAACGCGTCCCGTTT
Nr1h6 WHL22_41005_0.1 ENDOGENOUS CCCTCGTCCTGTAGGAAGCAAATGCGAATGCGGATGTATCATCCACAACAAGCCAACTCCCGAGAGTGAACCCGTTCCAGTCGTAGAAGTATCGTCATCG
Nr1h6b GLEAN3_15456.1 ENDOGENOUS GTTGAGGTGTGCCGAGAACTACGTTCCGGAGCGCAATGTAATCGTTGACGACATCACAGGCAGCGAATGGTCCTTCGAGTCCATGTTGTCATCAGGGTTT
Nr1h6c WHL22_609334_0.1 ENDOGENOUS CGCTGCTTACATACGGTTCGACATATACTCGGCTTACTCAGGCCCAGGAACAACTGATGTACACATTGGAAAAAGGATACAATGCCTCAACAGAAGTTCT
Nr1m1 WHL22_595573_0.1 ENDOGENOUS TGCTTACAGCAGGCTACCTATGTCTACTATCTCTAAGATGCTACGATCAGGACAACCTGTTATATTAATACCTAAAGATGTCTCCAGGGAAGGGAGGGAT
Nr1m2 WHL22_383507_0.1 ENDOGENOUS ATCGATGCATTATCTCCGTCTGGCGGAGTACACTCAACAGGTCAAAAGAGGAGCGATGACAAATGCTGGGTGTGTGGAGAGAAATCGAATACCTTCCATT
Nr1m3 WHL22_21036_0.1 ENDOGENOUS TTAGCATGCTTGGCTGTGACTACAGGTTCTGGGACGAGCTCTTTGACTTCTCCAGGAGCTTCAACAACCTCCAACTGATCAAGGAAGAAATTGCTCTCTT
Nr1m4 WHL22_175730_1.1 ENDOGENOUS CCTCATCGGCTGCTGGATCTCCTGAGACATTATCAGGACAGTCTATGCTTCCTCATCGTACAGGCTCTGGCAACAGAATAGATTTCCAGACGATAGCTTG
Nr1x WHL22_581390_0.1 ENDOGENOUS GGAACCAATGTCAATCATGTCGACTCAGGAAGTGCATCCTTATGGGCATGTCCAAAAATGCTGTTCGTTTTGGAAGGATGTCCAAACGAGAGAAGATGAA
Nr2C WHL22_96335_0.1 ENDOGENOUS GCGGACAGTCCAGAAACAGCTCTTGTATTCTTGCAGAGGACGTAGTAACATGGAAGGCTGCTGTGAAATCAACAAAACGAGTCGGAATAGCTGTCAGTTT
Nr2e6 WHL22_15174_0.1 ENDOGENOUS CAGAATGCAAACCTACAATGTTACAGGAGAAAGGCCATGATACTGAAATTCGTGAGGGACACATGAATGTTTCTCCACAGAATTGTGATGATACACCCAC
NtL WHL22_259272_0.1 ENDOGENOUS TGAATGCTATGCCCTACGACGATGATAACTTTGAGTCGCCATCGACATCACCACCTACATACGCCGAGCTCACACCCGCTGTCAATCACACTTTCAATCA
Nurr1 WHL22_220967_0.1 ENDOGENOUS CCCGAAACAAGACGCATCCTCACCGCCTTGTATTGTTCAAACGCCAGAAACCTTCTCATCAAACTATAGCAGTCAACCGGTTTGCACTACCGCCAGCAGC
Osr GLEAN3_24877.1 ENDOGENOUS ATAGCACCCTGCGGCGCCTAGTACTCAGCGGCTCCTCGTCAGTGCCATCATCGCGCCAGCACACATCATTGGGGTCTTCGTCGGGGGCACCGCCCAAGAA
Otp XM_001176278.1 ENDOGENOUS CCACCGTACTCGATTCACACCGGCCCAACTGAACGAACTGGAGAGAAACTTTGCCAAGACACACTATCCTGATATCTTCATGCGGGAGGAGATTGCGATG
Otx WHL22_532435_3.1 ENDOGENOUS CGACTGCGGCGACACCGGTCGATCACCGGTACCATCACACATGGAACCGCCAGGTGGGGCTAGGGTACCATACCCGATGCACCTTTACCCTTACCCGTAT
P3a2 WHL22_405480_0.1 ENDOGENOUS CCATAGCAACAGGGAAGAAACGCAAGAGACCGCATTCTTTTGAGACAAATCCTTCCATTCGGCGTCGCCAACAAACAAGATTGATCAGGAAGCTGAAAGC
Par1 WHL22_718026_2.1 ENDOGENOUS AGGTTCTAACTGTTCTTGATGTGCCTGAGTCGATTTCCTCTACAGACAACTCGGGGTCCAAAGTCACCTTGTATAAGATCAGCATGGAGTCCAATGATAT
Pax1-9 SPU_006683_1.1 ENDOGENOUS TCCTGGTTAAAGACCCATCAAAACTAAGCGCAAATTATCGCCAGCATGTCAGGTTTCGATTCGACGTGGTTGCCATGTTCGAAGGCTTTGGAGTGAATGC
Pax2/Pax2-5-8 XM_788689.1 ENDOGENOUS CTACCTGATGTCGTTCGCCAACGCATCGTCGATCTCGCACACAGCGGCGTCAGGCCGTGCGATATCTCAAGACAACTACGGGTTTCACATGGATGTGTTT
Pax4L/Hypp_886 XM_001200264.1 ENDOGENOUS AGGGACAAGTTCACTTCCCGTCGGTCCCTAGAGAGAACCAGTGTTATCCTACTAATAGCATGATAGTGGGGAATCCAGATCTTGAGACTCAATGGGCGGG
Pax6_1 WHL22_585512_0.1 ENDOGENOUS TTCACTGCTCAACAGATAGAGGAACTTGAGAAAGAATTTGAACGAACACATTACCCAGATGTCTTTGCACGAGAGAGGCTGGCACAGAAAATTGATCTAC
PaxB AF016886.1 ENDOGENOUS GACTCGTGATTCCTTTATCCGAGTCGGCAGGGTTGCACACATTGACACCTGTGCAGAGTGATACGAACGTAAGGGGCGCTTATACGCGAGTGGTTGAAAG
PaxC GLEAN3_00276.1 ENDOGENOUS CGATGCAGCTTCCGCACCTAATGCCACACCAATCGCTCTTACCTCATCCTGCGATCCCACATCCCGCCATGGTGCATCCAAGATTTGTTCTTCCAATCAG
Pbx/Pbx_1 WHL22_75202_0.1 ENDOGENOUS AAACGAAGAAACTTCAGCAAGCAAGCAACAGAGATCCTCAACGAATACTTCTACTCCCATCTTAGTAATCCATACCCAAGTGAAGAAGCAAAAGAAGAAC
Pdgfr/vegfrL WHL22_240520_0.1 ENDOGENOUS CAGCCGCTGACTCTCAAGGATCTTATCTGCTACTCATACCAGGTTGCTAGGGGCATGGAGTTCTTGACTTCTAAGAAGTGTATTCACCGTGACTTAGCAG
Pea XM_780608.2 ENDOGENOUS TGGAATGCGGCAGGGCGTTCTATGATGATGCAAGCGTACCGGAAAAGGCTCAAGAACAACACAATGAGCCGAGGCATGAGGTGGTGCGAGAAGGGCCTCT
Phb1 WHL22_302399_0.1 ENDOGENOUS ATGTTCCCAGATTGTGAAGCCGATAGACAAGGCTCTCCGTCAGCTGAATTCTTTGGAGATGTGATGAAACATGATAGAAGCAGCACAGGACGTTTACCTA
Phb2 WHL22_521451_0.1 ENDOGENOUS CGATATGGACGAAAGAGCGTCGCTGGACTCTTTCCGTGATGACCAACAGTCACCCTTGTCCGGTTCGTCGCCGCTTCACCCTCATCATCACAACGAAAAC
Phox2 WHL22_632079_2.1 ENDOGENOUS GACAACCTTTACCAGTGCACAGCTCAAAGAGCTCGAGAAAGCCTTTAATGAAACCCATTATCCGGACATCTATAAACGAGAGGAATTAGCCTTGAAGACT
Pitx1/Pitx1_1 WHL22_704986_1.1 ENDOGENOUS ATAAGGGACGATCCTGACGCCGTGATTTTGGATGATAACGGTGAGGAAATGAAAGATGGAAATTGTGAAAAATCGTGCAACGATCCCGACGCGGACGACG
Pitx2 XM_777251.1 ENDOGENOUS GGTGTGAAGGGTGGTCACGACGATGGCGACGATTCGGACAACGACCAGGACAACGGCAAGAAGAAGCGTACTCGTCGACAACGCACACATTTCACCAGCC
Pitx3/Pitx3_1 WHL22_11231_0.1 ENDOGENOUS CGATGACGAGTCAACCGATGTGCTTCAATCCGCCGACGACTATAAGCTCGACCTTCTCTGCAGCGACGCCCGTCAATGGCGTCGGCCAGCAACTGAACTC
Pknox WHL22_655290_0.1 ENDOGENOUS TTTGTCAACAGACTGAAGAGAGAGGGCAGCACATTCTTCATTGAAGATACAGAGATTGATACATTAATGATCAAAGCAATCCAAGTACTACGAATACACC
Pmar1b GLEAN3_14721.1 ENDOGENOUS GTTATCGACTTGGCCGTCATCGGTCGTAAGCGGAAGAGATCGTGCGACACCGTTGAGGTCGACCAGACCACACCACCTACCAAGAAGATGAATTCCGTTT
Pmar1c WHL22_462256_0.1 ENDOGENOUS CCACCGTCTTCACTGAGTTACAGCTACAGATTCTAGAGACGGCGTTCAACGACAACCAGTATCCTGATATCAATACTAGAGAACAACTTGCTTCAAGTCT
Pnr WHL22_485384_0.1 ENDOGENOUS CCAGAGATACGGGGAGTGAACCTTGTATGAAGCGTATATGTCCGGGTTTGACGTGCACAGTTTGCGGGGATATCTCGAGTGGCAAACACTACGGTATCTA
Pou4f2 WHL22_738139_0.1 ENDOGENOUS AGATAATCGAAATTCACCTGGTATCCTTGACAACGGAGACAAAAAACGAAAGCGAACGAGCATCGCTGCTCCTGAGAAACGTTCCCTTGAAGCATACTTT
Pou6/Hypp_2286 WHL22_701564_0.1 ENDOGENOUS ACAACATCTGTTCCTAGTTTAGTAACAACGCAGAATAGTCAAGCACTGCCCTCGCTTGCCACAGTAACGCAAGGTCTGATGCGTACCTCAGCAAATCATC
Ppar1 WHL22_46852_1.1 ENDOGENOUS AAGGTTTCTTCAGAAGAACACACAGAATGAAGCTAGTCTATAAACCATGTCCTTTCGTCAAGACAGAACCATGCAAGATCAACATAGCAACAAGGAATAA
Ppar2 WHL22_44643_0.1 ENDOGENOUS AATAGACACCGTCGAAACCACCGACGACTATTTCTTAGAAGTCAAGCCTGAAAATCACCCATTCGAAGTGGACAATGATGTCGAAGACATGGAGGCTTCT
Pric WHL22_636100_0.1 ENDOGENOUS CCCATACCTATCACCCTGTCAGCAAGTATTTGTAACCAGTGTGGTGGTGGGATCAGTGCGGGAGACATTGCTGTGTTTGCATCACGAGCCGGTCACAATG
Prox1 XM_776485.1 ENDOGENOUS TTTGTGCAGCGATACAGAATCACAAGATTCATTTGCGCAGGACAGAGTGGCGGAGGATCGCAGCAGTTTGCTTTATTCGGAAGAAGATATTGCGGAGAGC
Prx1 WHL22_486796_0.1 ENDOGENOUS TCATCACCATCATCATCAGCATCATAATGGTGGCCGAGGGTTCTCGGTGTCTCATCTTCTAAACCTGCAGGATGTAAGCGGGTTTGGCGATCACGGTCAC
Ptf1a GLEAN3_02677.1 ENDOGENOUS TACATCAATTTTCTGGCAGAGATGATCGAGAACGAGGGAGCTGACCTGGAGTCGCCAGCGACAAGTCCGGAAGAAAACCAGAAGAAAGTTATCATTTGCC
Pu1 WHL22_15960_1.1 ENDOGENOUS GTTATGGCTGGAAGGTATGTCACCGCGAGGTTACGACATCCAAAGACATCTACTAGATCTTGAGAGGTCCAAGCAAACAATGCTCGAACAATTGATTGAC
Rar WHL22_595420_0.1 ENDOGENOUS TTCCCGTTTCAACCCTCAAGATGCCAGTGTGACCTTCACCACTGGATTGACCCTAACTCAAGGTCAACTCAAGGCTGGTGGCTTTGGTAGTCTCCTTGAT
Rara WHL22_376236_0.1 ENDOGENOUS CTTGTATTCACTGGAGGACATCCCAGATGTAGACCTCACCTTCCCAGATGAAAGCTGTATTGATAGTTTCACTGATCCGTCCAACTCCCTTGGTGAGAGT
Rel GLEAN3_12203.1 ENDOGENOUS ATCGTCTGGTAGGGGATGGTTGCAGAGATGGTGTATGCACCAGAATGATTGATCCACAAAGACCAGAAGTAGTCTTTCATAAGATTGGAGTGCAGCGTAC
Reverb GLEAN3_17492.1 ENDOGENOUS TCAGATGAAGACGGAGCAGCTCATACTAAGCATCCATGAAGCACAGAAGAAGACCTTATGGGATTGGGGCATCCTGCAATGCAGGAGTTATAACCTTCTA
Rfx3/Rfx2 WHL22_19679_1.1 ENDOGENOUS CCTGCACAGACAACCATCATCGCAACACAGCCAGTCTCCTTTTACTCCATCCAGCCCACCTCGCACACCATCCAATCAAATCAACAGTTCCTGCAATTAG
Rhox3 WHL22_277630_0.1 ENDOGENOUS CCATGTCTCAGTGGTTAAAAAACGTACCTTCTCCGAGATGCTGGACGAGAGTTGTGTTGACGAGGGGAGGAAATCGTACTCGCCTCAGTCTCACAGAGTA
Riz WHL22_63053_1.1 ENDOGENOUS CAAAGAAGAGAACAAGGGTTGGACAAAAGTCTGTGAAAGCACCAAAATTAGAGGGAACTCCGCGTTCGATGGATGGAGATTTAGAGATTCCAGTCGATGA
Rora WHL22_499606_0.1 ENDOGENOUS CTGGCCCATAAAGCCGTGCCAAAGTCTTCCGGTGCAGTCTTACCAATTCGGTCCCACGCTTCCCTCCCGTCTTGGATTAAATCGGAAGAAAACAGGCCGA
Rreb1 GLEAN3_09642.1 ENDOGENOUS CACCATGTGTGGTAAGAAGCTGAGTTCTACCAGTTCCTTGGACCGCCACATGTTGATCCATTCTGGAGAGCGTCCCTTTACATGTCCTCTGTGCGCCATG
Rrm/P53L/Pink1L WHL22_747798_0.1 ENDOGENOUS AGCATGGTGCGCGAAACCAGGCATCTTTGGGTTGGAAATTTACCGGATAATATTCGAGAAGACAAAGTTATAGAGCAATTCAAACGGTATGGTCGCGTGG
Runt1/Runt1_1 NM_214614.2 ENDOGENOUS CCGGTACGGAGGAACAACCTACATAACAGTTATAAGATGGCCGAAGGGGGCCAGAGGAATAAGGCCTCATCCGTCTTCAAAGGAGGAGAACGGTCTATTG
Runt2 WHL22_425096_0.1 ENDOGENOUS CTAGACCAAGACGACCAAAGTCAAAGCATGATGATCCTCTGTGCTTCTCATCGATCATTGACACAGGCCACGCCCATTCTTATGGGTTGGTCATCTCTCA
Rx GLEAN3_14289.1 ENDOGENOUS GCACGCAGCAGCGGTCGCTGTCGCTGCAGCCGCCAGCCAAACAGCTATGTTTCCTTTGCTCAGCCCGACTCATCTCACATCGCCTCCTGGCCGCCCTGGG
Rxr WHL22_717794_2.1 ENDOGENOUS ATTATGGAGTCTACAGTTGTGAAGGTTGCAAAGGGTTCTTCAAGAGGACGGTACGGAAAGACCTCACGTATACCTGTCGGGACGATCGTAACTGTATGGT
Sage_1 WHL22_633149_0.1 ENDOGENOUS TATGGAAGACACACTGTTGCTAAAGCAGGAGCATGATGATGATGTCGTTTTACAACAAAGTCCTCTCGATGAAGACCAGTTAAACGGTCTTTCAGAGTCA
Satb1/Mib1_1/Hypp_2193 WHL22_589656_2.1 ENDOGENOUS CATCGTGCCATCAACGTTACAACTCAGAGATCTTGTCAGGGTAGCCTTATCCAAGCTGGATTACCCACCGGAAAGAGCGAAAAATGCAACAGGTGTTATT
Scl XM_787384.1 ENDOGENOUS ACCGGTGCTGGAGCGGGTAGGCTCGGGTAAAGTCGTACGCCGAATCTTCACCAATAGCCGAGAGCGATGGCGGCAGCAGAATGTTAACTCTGCATTTTCC
Scml1 WHL22_128919_0.1 ENDOGENOUS TGCTTCAGCCTCCTCTTGGTTTCAGAATGAATGCCTCATCGTGGCCCATGTTTCTACTGAGAACACTCAACAATGCCAGCATAGCTCCGACACAAGCATT
Scratch WHL22_758741_0.1 ENDOGENOUS CAGCCCTACCCTTCCTCATCATGGAGTAAGCGTCACCATCAACAATGGTTACATCCACGATATCACTCCATCGCCGTCTTCTCCTCCTAGTGAGCCCTTG
ScratchX GLEAN3_15640.1 ENDOGENOUS CATGTGGGACTGCTTTGCAGCAGAAACAGCCATCCAGAGTTACTATGGTTACTCCAGCGTTATTCAAATTCCATCGGCGAGGTCTGTTGTCTCAGTGCCC
Sfrp1/5 WHL22_146031_1.1 ENDOGENOUS CCTCAGCCTGTGTCAGAACATCGGATACACTCGTATGCGAATGCCGAATCTTCTGGAGCACGATTCCCTAGATGAGGTTAGAAACCAAGCTAAAAGTTGG
Shr2 XM_777791.2 ENDOGENOUS AGCACGCTAGCCAGCGTAGTCACATCCTTAGCCAATATGAACAAGAAGACGGAAGAAGGGCCAAGTCATTCACAACAGATCTATTCTCCATCTCAGACCC
Sim/Sim_1 WHL22_424996_0.1 ENDOGENOUS GAAGGTCTTGGTGATTCGTGGGGTAGCCGCAACATCTCGACTCTAGATCACATGACCAGGGAACTAGGCGCACATCTTTTGCAGACCCTTGATGGTTTTA
Six1/2 six12_742614.1 ENDOGENOUS GGTTGCCTGCGTCTGCGAGGTTCTCCAACAATCCGGCAACATCGAGAGACTTGGCCGTTTTCTCTGGTCGCTACCTGCCTGTGAGCATCTCCACAAGAAT
Six3 XM_776603.2 ENDOGENOUS AAAGAGAGAACGCGGAGTTTGCTCCGGGAGTGGTACCTCCAAGACCCTTATCCTAACCCTACCAAAAAACGTGAACTGGCTCAAGCCACAGGACTTACAC
Six4 WHL22_121462_0.1 ENDOGENOUS CAACGCTGGGATATCATTACCCGTGCCCACCAGCTTGCTATCGAATGTAGAGAACTTAACATGTAGTAAAAGCAAGGAAGTGGAATGCATGAACTCGCAA
Slc16a4L_5/Pric WHL22_635901_2.1 ENDOGENOUS GGTGCACTTGTGAGGCATTTTGGTGTTCGTTGTGTGATGATTGCTGGTGCCATCCTCTCTGCATCTGGCTTCTTGGCTGCTTCATATGCTCCCAACATTA
Smad_ip sip_742605.1 ENDOGENOUS CAGCGACACTGCAATCATCTATCCTGAACCTGTAGAAGACATGGACGGAGTCAATGGCGATACAGATGACCCTGATACTCCTGAAGGAAATGACAACGAA
Smad1/5/8_1/Smad1/5/8 WHL22_347626_0.1 ENDOGENOUS CTTCACCGATCCATCCAATAACCATGATCGCTTCTGCCTGGGTCTTCTCTCTAATGTCAACCGCAATTCCACCATAGAGAATACAAGGAGACACATCGGA
Smad2/3 GLEAN3_17642.1 ENDOGENOUS TGGATTCACTGACCCATCAAGCTCTGAAAGATTCTGTCTTGGTCTTCTCTCTAATGTCAATCGAGATCCTCAAGTTGAACAGACACGCAGACATATTGGT
Smad4 XM_001181042.1 ENDOGENOUS TGCATATCACTATGAGCGAATTGTGTCACCTGGTATTGATCTGACTGGGCTCACATTACAACACACAGCTGGCCCTCCACGTGTGGTTAAAGACGAGTTT
Smad5 GLEAN3_00739.1 ENDOGENOUS ACGCGTTGTTAGGGGGCGTGCCGCTCGCCTTCGTTTCACCATTCTTCGAGAACGAATACACCGGGACCTGGCCGATACGGCGTCATTCTTCAACGAGATT
Smad6/7/Smad6/7_1 WHL22_579194_0.1 ENDOGENOUS TTTATGTTGCCAGCTATTTCGTTGGCCAGAACTCAAGCATGGAAGCGAACTCAAACGGCTCAAATTTTGCTGCGAAATTAGCCAACAAGGCGACGAGGAA
Sna AY372519.1 ENDOGENOUS CCCGTCAACATTCCGCATCCAGTTATCCACAAACCCGAGCCTCTCCAGGCCATTCCCAACCCATCGGCCTACTGGCGACACCATCCGAATGTGATCTACA
Soxb1 NM_214474.1 ENDOGENOUS ATGATGCACCACGCACCGTCTGGCACCTCAGCCGCCAAGTCCGAACAAGCGTCGATGCCAACAGAGCGAACGCAGTCAGCAGCCACCGCCGTCTCCGCTG
Soxb2 NM_214473.1 ENDOGENOUS TGCCTTTATGGTTTGGTCAAGAGGACAGAGGAGGAAACTTGCTCAGGAAAACCCTAAAATGCACAACTCCGAAATCAGCAAGAGGTTAGGAGCCGAATGG
SoxC XM_792991.2 ENDOGENOUS GCTGCTAAGACCACCAGCAGCAAACCAAAAGCCAACAAGCCCAAGTCATCATCGAAATTGACGAAGATGAATGGCATCGTGATCGACCAGATGCACCCGC
SoxD1/Sox6L NM_214472.1 ENDOGENOUS ACTATGAGGAACAAGCCCGACTTGACAAAGCTCATCTGGAGAAATATCCGGACTACAAGTACAAGCCGCGCCCTAAGCGAACGTGCATCATCGACGGCAA
SoxE GLEAN3_16881.1 ENDOGENOUS GCTGGTGTCGATGTCCGTGACTTTGGTGGCGACATCATGGGCATGGAGGAGTTTTCATCGGAGGAGCTGGACCAGTACATCGTGCAGACCATAGCTAGTG
SoxF GLEAN3_14170.1 ENDOGENOUS ACAGTCCTGGCATGGTCATCAAGTCTGAACCAGGGGTATACGAGTTCCAGCAGCAGTGTGTGGTAGATAACGCTGAACTGACAAACCAAATGAATGTAAC
SoxH WHL22_173047_0.1 ENDOGENOUS ATGGCTAACGTTATGATGCCAGGACCACGAGAAAATATCAAAGATGCAAAAACACCAACTCAATCAAAGGTTCTAGTGCCTAAAGCTGTGACGATTACAA
Sp2/Sp2_1 WHL22_380228_0.1 ENDOGENOUS TGGTGGCCCGATGTACATTGAAGTTGGCCCTGGGGGAAATATTCCATCTTCGTCAGTGGGCGGAGCTACTCCAACTAAGTCGATTAATGCTGCTAATATT
Sp5 GLEAN3_24189.1 ENDOGENOUS AGTCTATGGCAAGACCTCGCATCTCAAAGCTCATCTGCGTTGGCACACAGGCGAGCGACCCTTCGTTTGCAACTGGCTTTTCTGCGGGAAGTCGTTCACG
Sp8/Sp8_1 WHL22_384609_0.1 ENDOGENOUS CCCGCATCTCTGTGGACATTCTGCTTATGAATCGTGGCTGAAAGCAGCAACTTCAGCGTCTATGTTATCGCGGGAGAACGGTGTTCATGGCTTCAGTCCT
Spalt XM_776283.2 ENDOGENOUS ACCAAGGAGCGTCCATTCCGCTGTGATTGCTGTAGCAAGGGATTCTCCACCAAGGGTAACCTCAAGCAGCACATGCTGACTCACAAAATCAGAGATATGC
Spz12 NM_214616.1 ENDOGENOUS GAGTGTCTTCATGGAGTGAGGCCCTACGAATGCAAAACTGCGGGAAACGGTTCGCCCAGAAGAGCTGTCTTACGCGTCACACCAAGATCCACACCGGAGA
Srebp WHL22_192617_0.1 ENDOGENOUS TCGGTAATGAATTCGGATCCACATCTAAATTCTGTGAAAAAAGAGGAGGATGAAGATGCTTTTCTTGATGACCTTGATCTGCAAGATGAGGACATGAGTT
Srf GLEAN3_27774.1 ENDOGENOUS GAAGCTGAAAAATGGTATCAGGGACCATGGATCATGTTTACCGGACAGTGACAGTAGCTCTGTTGGTACGGGCTCCGAGCTAGCGGACCGGGACCATGAC
Stat WHL22_738007_3.1 ENDOGENOUS CACTGGATAGAGGCACAGAACTGGAGTTCAATTGACATTGATAACCCAGTGTTTGAGCCTGATGCTATTGATCTACTTCATGGGATGATCAAACAGGTCC
Tbr WHL22_503644_0.1 ENDOGENOUS AGAAGAATTACAACACACGACTGATCAGGGTAATGAACACGTTGCTGCAACAAATCCAACTAAGTTTCAAAAGACGACGGAACCAGAGGAAAGCGATAAA
Tbx1 WHL22_21153_2.1 ENDOGENOUS GATTGTCACAAAAGCCGGCAGACGGATGTTTCCTACCTTTCAAGTGAAGATCTCTGGGATGGACCCTATGGCCGAATACATCCTTATGATGGACTTTGTT
Tbx2-3 GLEAN3_23386.1 ENDOGENOUS TCCATTCGCTAAAGGTTTCAGAGATACAGGGGCAGGGAAGAGAGAGAAAAGGAAATACATTGGCGCGACGGGCACATACGAAATCGACCACGGTGATGAC
Tbx20 WHL22_730224_0.1 ENDOGENOUS TCGTGCAATCGCATCACATCCTCCAACGCAATCATCTTCAGCGACAACAACAACATCATCATCATCATCTGCTTCCGCAACAACACAGCTTGGTATCACT
Tbx4 WHL22_625687_0.1 ENDOGENOUS TCAGAGCGAGCAAAAGCCTTTGCAATAGACTCCATTTTGTCATCGACTAAATCTAGTGCAAAATTAGAAATCGACGATGTGGACAGTGGAAAGCCAACAT
Tbx6/16/Tbx6/ XM_791917.2 ENDOGENOUS ACGGTTGCGATGCGAGGTTGTCTGATTATAACACGGGAAATGGAATGGTCGATACGTTATCGCCCTGTTACACGCAGGACGGTGTCATGGATGACAACGG
Tead4/ GLEAN3_21210.1 ENDOGENOUS TGAGATCTCGCGGTCGCCCATGTGTGAATACATGATCAACTTCATCCACAAACTCAAGCATCTCCCAGAGAAGTACATGATGAACAGTGTTCTAGAGAAC
Tel XM_791264.2 ENDOGENOUS CAGCGCATGTTCGAGAAACAACCCTTGCGACTTCCCGGCGGGAAAAACCTCCACGACAACTTCAGCGAGTCGGTGATGGATTCCTCTCAGGTTCCGCCGT
Tgif XM_775847.2 ENDOGENOUS AGCTCTACCTATCTCGCTTGGCTAACCTCACTCTTCTCCAGGTGTGCAATTGGTTCATCAACGCTCGAAGACGTATCCTGCCAGAGATGATTCGTCGCGA
Thrb/Thr WHL22_211956_1.1 ENDOGENOUS AAGCGAGGCAGAGAAGAAATGTTGAGACAGACTGGTCTAATTGCTAATAATCAGCTAACAGATCATGAAGAGGCTTTGATCAGAGCTATCTTAGTAGCTC
Tle1/Groucho WHL22_510742_1.1 ENDOGENOUS AACCTGGGCAGCCATTCAAATTCACAATTCCAGAGTCATGTGATCGAATCAAGGAAGAGTTCAGCTTCTTACAGGCACAGTATCATACGTTAAAAATGGA
Tll/Tll_1 GLEAN3_27487.1 ENDOGENOUS TTCATGAGTATCAGATGGGTGAAAAACGTTCCCGCCTTTATCGGCCTACCATACTCAGATCAGCTCACGTTACTGGAAGAGGGCTGGAGAGAGTTATTTA
Tlx3 WHL22_207227_0.1 ENDOGENOUS CCTCCTCTTAACCCGAGAGTTGAGCGACCACTAGCCTTCAGCATCGATCGGATACTTGGTCTCCCAGGTTATACATTCCAAACCAACAACCCACTTCATC
Trh WHL22_74366_0.1 ENDOGENOUS TGATGGGTTGTTCTGTCTTTGACTATGTGCATCCTGGAGATCATGCAGAGTTAGCTGAGCAGCTTGGAATGAAGCTACCACCCAATAAGACATCTTCATC
Tsc22d2 WHL22_509140_0.1 ENDOGENOUS GGCTAATAAACAAGATCCAGATCCAACGTCAGACACAGAGCAGAATGTTAATGTGGATATGACTAACCAGAGATCAGGCAGTAAAAAGAAAGCCTGTTTT
Tulp4L_1 GLEAN3_16617.1 ENDOGENOUS GGGTGGAACTCAGCCAGTAGAGAGTATCAGTGCTGTCAAGTTCTACGATACGACCGGACACCTTCGGTTTACACTTAACATTCCATCCCAGAGACCACTG
Tulp4L_2 WHL22_608861_0.1 ENDOGENOUS CACCATGGATTCCAACAATCACAACCTAGTTAGTGAGCTGACTCAACAGAATAATGCCGAAAGTCAAACCGTTGAGGAGGGAGAGACTGATTCGATTCCA
Twi WHL22_118674_0.1 ENDOGENOUS TCAGATAAACTGAGTAAGATACAGACTTTGAAGCTAGCATCGAGGTATATTGACTTTCTGTTCCAAGTTCTAAAGAGTGACGAGGAAGATCAAAAGATGG
Unc4-1/Unc4.1 XM_001203119.1 ENDOGENOUS AGCGAGATCGATTCAGAATGCATGGACAGTATGAGTATTGATACAACGGAGGAGCAGCGAAAACTCCCGGATTCGCCGCGCTTCAAGTTAGCGGCACGAA
Usf WHL22_467508_2.1 ENDOGENOUS TACTTGATCAGACACTAGACCAAGGACCACAAGACAAGGATAAAGATTTAGAAGAGGAGGTTACAGTACATCTAACAGCAGATGGAGATCAGGTTGTTCA
WHL22.290173.0 WHL22_290173_0.1 ENDOGENOUS GAATTCATCATCAACTCACGCCCTGATATCACTACTAGAGATCGGCTGTCACGCACACTCAAACTCAGTAACCTCTTGATTCATGTTTGGTTCCAGACCC
WHL22.767290.0 WHL22_767290_0.1 ENDOGENOUS TCCATGGAATGGCTGGGTCAACTGAATATACCAGCATCTTTGAATGGAAATTCTCCAAATGGTAAGAATGGACCTGGATCTACCAATTCGTTGGACCCAT
Whsc1/Trx WHL22_117840_0.1 ENDOGENOUS GCACACCTCCTGATCAGATGGGCACTCCTATAAAACAGAGTTCAGTTATTCCAACTCCGCCTTCTGATTCAGGACCCTTTGACACTTCAGAAGCGATGTC
Xbp1 WHL22_490709_0.1 ENDOGENOUS CGAGTCACCTGGGTCCGCAGCACTCATTTTTCCTCCGCAGCAGGAATCGACTCGACTCTTCCTCACCTTCCTGTCGACGTTGCTGATGTGGAGTCTGACG
Yyi WHL22_224218_0.1 ENDOGENOUS CCCAAAATGGCGGATGATCCGGACATCATTGACACCGAAATTGGATTACCAGTTCAAGAGGTGGAGATTGAGAGCATACCAATGGAACATATTGAGGGTA
Z111/Glis1_1 WHL22_242915_0.1 ENDOGENOUS TCGAAGAAGGTACCGAAAATGGATACAGGAGAAGATAAGAATTCTCGGATTCTTTCTCAGAAGTTAGGTGATGTCAATGCAGCAGATTTACCAGAAGGCC
Z13/Z474 WHL22_407274_0.1 ENDOGENOUS ATCAACCGTTGTTAACTGGCTGATTTCATCGTCGTCATCCTCGCCAACCTCAACGGCTCCACTTAGCGGTAGCATTAGCTACGGTCCCGTGCCTACGAAC
Z166/Rxr XM_788753.2 ENDOGENOUS GAGGTTCACGTGCGACGTTCCCACAGCGGTAAGCGTCCTTTCGCCTGTGACATTTGCCAAAAGACGTTCGGCCACGCGGTCAGTCTCAGTCAGCACCGCG
Zhangfei WHL22_126978_1.1 ENDOGENOUS ATGGTCGAGAGTGCTTTATCTCCGCCGTACGACGGGAGCGAATTTCAGGAGCTATTTCCTGAATTGACAGGCGTGGAACCAGAAGAAATGGTTGACATCG
Zic/Zic2 GLEAN3_28583.1 ENDOGENOUS CTCGGCAGCCGAGACCACCGCGCTCAGCTCGGGCTTATCTGATAGCACGGGGATGACGCTGAACATGAATTCCTACGGCATGGACACCTCTCATATGACG
POS_A(128) ERCC_00117.1 RNA TCAGGCCTTGCCCTTACTAATGGCGCGTTGTAACGGGCCTTGAGGGAATGTCACTATTGAGGCACCCGTTCGACCCTCAGAGATATACCATTCCGCCTAT
POS_B(32) ERCC_00112.1 RNA ATGAAAGCGCTGCTACTATGATAAGAGTACACGTACAGGTCTCGCCCGATTGGATTATGGCGAGCTGCCGCATTGACGGACATACCTTTGAACGTAATCG
POS_C(8) ERCC_00002.1 RNA GCCGCTTTCGCTCGGGTCTGCGGGTTATAGCTTTTCAGTCTCGACGGGCTAGCACACATCTGGTTGACTAGGCGCATAGTCGCCATTCACAGATTTGCTC
POS_D(2) ERCC_00092.1 RNA TACCTGGCATTTGGGCACTTCTTGCGTTTAAGCGGGAAAGATCGCGAGGGCCCGCTATTTGCGATACTTCCCATGTCGGTGCCGTCGCCTCTATGTACTC
POS_E(0.5) ERCC_00035.1 RNA GGTTGAATTTGAGCGGATGGGCTCAACTGCGTCGTAACCGGTAGATACAGGGCATACGAGCCTCCCTATTTAACGGCATCATCCCGCGTAGTGCTGGTCA
POS_F(0.125) ERCC_00034.1 RNA ACGAAGCTGTTCGGCCGCACGCAAGTACCTCCCACTTAGAAAGCGAATAACCCAACGACCGTGTTCAACCCTGGCCGTCTCTCAACCAGGTATGCAATCA
NEG_A(0) ERCC_00096.1 RNA AACCGCCGCATACGGCCGATTGTCGCAGCCCGGGTCGATTATAACAACGGTGCAATCTCAGCTAAACCGACGCAGTTTTGCTCCTTGGATTCTGAGCCCG
NEG_B(0) ERCC_00041.1 RNA GCACTGGCATTGGTCGTTTCAGGAGGCCATACAGAACTGGTTTATATGAAGGAACATGGATCATTTGAAGTCATTGGGGAAACCCTTGATGATGCGGCAG
NEG_C(0) ERCC_00019.1 RNA GTACAGGCTGCTGGCTCATGTTTCCTTCTACGCTGCACTTGCGGGCATAGAGGTCGGTTGCGATCTATATTCGGAGATAACTATTCACCCAGCGCCACTC