Difference between revisions of "CRISPR/Cas in Echinoderms"

From EchinoWiki
Jump to: navigation, search
Line 1,721: Line 1,721:
  
 
([https://www.echinobase.org/literature/article.do?method=display&articleId=48853 Yaguchi et al. 2020])
 
([https://www.echinobase.org/literature/article.do?method=display&articleId=48853 Yaguchi et al. 2020])
 +
 +
</div>
 +
|}
 +
 +
 +
 +
'''Table of sgRNA sequences for ''Hemicentrotus pulcherrimus'''''
 +
 +
This table shows the gene specific spacer RNA sequence that is 5' to the constant scaffold RNA sequence. The gRNA binds to the reverse complement of the DNA sequence indicated (other strand).
 +
 +
{| style="border:solid 1px black" class="sortable wikitable"
 +
!Name      !!Synonym    !!sgRNA sequence 5-3'!!DNA sequence!!Edits Yes/NO!!References   
 +
|-
 +
|
 +
<div class="style8" align="left">
 +
 +
TBD
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
HpPks1 sgRNA#1
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
GUGGUGUCUUUGUCGGUAU
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
GTGGTGTCTTTGTCGGTAT
 +
 +
</div>
 +
|
 +
<div class="style8" align="center">
 +
 +
NO
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
([https://www.echinobase.org/literature/article.do?method=display&articleId=47348 Liu et al. 2019])
 +
 +
</div>
 +
|-
 +
|
 +
<div class="style8" align="left">
 +
 +
TBD
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
sgRNA#2
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
ACUGAGGGGUUUGAGGACAA
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
ACTGAGGGGTTTGAGGACAA
 +
 +
</div>
 +
|
 +
<div class="style8" align="center">
 +
 +
Yes
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
([https://www.echinobase.org/literature/article.do?method=display&articleId=47348 Liu et al. 2019])
 +
 +
</div>
 +
|-
 +
|
 +
<div class="style8" align="left">
 +
 +
TBD
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
sgRNA#3
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
UGAGAGGGUUGUCACGUGUG
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
TGAGAGGGTTGTCACGTGTG
 +
 +
</div>
 +
|
 +
<div class="style8" align="center">
 +
 +
Yes
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
([https://www.echinobase.org/literature/article.do?method=display&articleId=47348 Liu et al. 2019])
 +
 +
</div>
 +
|-
 +
|
 +
<div class="style8" align="left">
 +
 +
TBD
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
HpPKS 82-105
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
GGAGCAAUAAAACCAGCUGG
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
GGAGCAATAAAACCAGCTGG
 +
 +
</div>
 +
|
 +
<div class="style8" align="center">
 +
 +
Pool Yes
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
([https://www.echinobase.org/literature/article.do?method=display&articleId=48597 Wessel et al. 2020])
 +
 +
</div>
 +
|-
 +
|
 +
<div class="style8" align="left">
 +
 +
TBD
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
HpPKS 101-123
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
GGGGAACUCGCCAUGCUUG
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
GGGGAACTCGCCATGCTTG
 +
 +
</div>
 +
|
 +
<div class="style8" align="center">
 +
 +
Pool Yes
 +
 +
</div>
 +
|
 +
<div class="style8" align="left">
 +
 +
([https://www.echinobase.org/literature/article.do?method=display&articleId=48597 Wessel et al. 2020])
  
 
</div>
 
</div>
 
|}
 
|}

Revision as of 22:27, 1 December 2020

Welcome to the Echinobase CRISPR/Cas resource. A brief literature and method review is followed by tables of gRNA spacer sequences.

Updated December 2020


S. purpuratus genome editing to create insertions and deletions

To date CRISPR/Cas9 has been used to introduce insertion and deletion mutations (indels) into S. purpuratus nodall (Lin and Su 2016), polyketide synthase 1, gcml (Oulhen and Wessel 2016), nanos2l (Oulhen et al. 2017) and dll1 (delta) (Mellott et al. 2017) genes. Attempts to mutate foxy (Oulhen et al. 2019) were unsuccessful. A number of different methods were used for gRNA synthesis (several using pT7-gRNA) and NLS-SpCas9-NLS (pCS2-nCas9n (zebrafish codon-optimized), or pCS2-3xFLAG-NLS-SpCas9-NLS (codon optimized for human with a 3XFLAG-tag) were used in these studies (see below for details). The gRNAs and mRNAs were microinjected into fertilized eggs.


Single nucleotide edits

Additional studies fused a deaminase to two mutants of SpCas9 for achieving targeted, single nucleotide edits to alx1, segment polarity protein dishevelled homolog DVL-3 (Dsh) and polyketide synthase 1 (Pks1) to produce STOP codons (Shevidi et al. 2017).


Reviews

Reviews of the methods are available (Cui et al. 2017; Lin et al. 2019).


Editing other echinoderm species

Editing technology has also been used in Hemicentrotus pulcherrimus (Liu et al. 2019; Wessel et al. 2020) and Temnopleurus reevesii (Yaguchi et al. 2020).


Design overview

CRISPR systems in nature are composed of the Cas9 nuclease and two RNAs, the CRISPR RNA (crRNA) that binds to a complementary DNA sequence and binds to the transactivating RNA (tracrRNA) that also binds to a specific Cas9 protein. For ease of use the crRNA and tracrRNA have been combined into a single guide RNA (sgRNA) molecule for use with the Streptococcus pyogenes Cas9 (SpCas9). The sgRNA has the target gene spacer sequence and the scaffold sequence that interacts with the Cas9 protein. The design of the gRNA target gene specific spacer sequence can be performed using online tools such as CRISPRscan. Briefly the software will scan for the NGG protospacer adjacent motif (PAM) sequence then evaluate the 20 nucleotides that are 5' of the PAM site for their suitability as a spacer sequence. Favorable spacer sequences are more than 50% GC, 20 nucleotides in length and do not have "off-target" binding sites. Additionally, if using T7 RNA polymerase to produce the sgRNA then two 5' GGs should be considered, editing occurred with an 80% frequency with GG-, 75% NG-, 60% GN- and 37.5% if NN- (Thomas et al. 2014).


Method overview

Published methods have used microinjection of RNA into embryos.

The capped mRNA for Streptococcus pyogenes Cas9 with nuclear localization signals was produced using either linearized pCS2-nCas9n or pCS2-3XFLAG-NLS-SpCas9-NLS as the template for the MEGAscript SP6 Transcription Kit or the mMESSAGE mMACHINE SP6 Transcription Kit. The RNA was then purified.

To make the gRNAs several approaches have been used. The pT7-gRNA was designed to clone the gene specific spacer/target sequence into BsmBI restriction sites. The vector contains the T7 promoter and the gRNA scaffold followed by a restriction site for linearization prior to RNA production. More recently the pT7-gRNA plasmid has been used as template for a primer containing the T7 promoter, spacer sequence and an overlap sequence to prime the PCR and add the scaffold. This overlap approach has also been used with a synthesized scaffold oligo for PCR (eg. 5’ AAAAGCACCG ACTCGGTGCC ACTTTTTCAA GTTGATAACG GACTAGCCTT ATTTTAACTT GCTATTTCTA GCTCTAAAAC 3' where the overlap sequence is underlined) . The sgRNA is then produced using the MEGAshortscript T7 Transcription Kit and RNA is purified.

For microinjection the 500-1000 ng/ul Cas9 mRNA and 150-400 ng/ul sgRNA are mixed (literature varies). The NLS-Cas9-NLS protein is approximately 4.4X the mass of gRNAs so sgRNAs are in excess. If 50pl is injected this is on the order of 10^7 molecules of Cas9 mRNA and 10^8 molecules of sgRNA.


Table of sgRNA sequences for S. purpuratus

This table shows the gene specific spacer RNA sequence that is 5' to the constant scaffold RNA sequence. The gRNA binds to the reverse complement of the DNA sequence indicated (other strand).

Name Synonym sgRNA sequence 5-3' DNA sequence Edits Yes/NO References

nodall gRNA1

E1_123

GGCCUCAGGUCGCACCAGA

GGCCTCAGGTCGCACCAGA

NO

nodall gRNA2

E1_157

GGGCGUCCGGUGUGAUAAG

GGGCGTCCGGTGTGATAAG

Yes

nodall gRNA3

E1_272

GGAAGAAUGCCAAGCCAUUG

GGAAGAATGCCAAGCCATTG

Yes

nodall gRNA4

E2_63

GGACAGCUUCGUUGGCGGGC

GGACAGCTTCGTTGGCGGGC

Yes

nodall gRNA5

E2_777

GGUAGGCGUUGAACUGCUUU

GGTAGGCGTTGAACTGCTTT

Yes

nodall gRNA6

E2_885

GGUGUCCGUCUCUCGGGU

GGTGTCCGTCTCTCGGGT

Yes

LOC588806 gRNA1

Sp.PKS1.175(+)

GGUGGUGUCUUUGUCGGUAU

GTGGTGTCTTTGTCGGTAT

Yes

LOC588806 gRNA2

Sp.PKS1.547(-)

GGUGAGGGGUUUGAGGACAA

TGAGGGGTTTGAGGACAA

Yes

LOC588806 gRNA3

Sp.PKS1.806(-)

GGAGAGGGUUGUCUUUGGUG

GAGAGGGTTGTCTTTGGTG

Yes

gcml gRNA1

Sp.GCM.63(+)

GGCCGCCGGAGCUGCCGGGU

GCCGCCGGAGCTGCCGGGT

Yes

gcml gRNA2

Sp.GCM.390(+)

GGCUGUUCGGCCAGCCACUU

CTGTTCGGCCAGCCACTT

Yes

gcml gRNA3

Sp.GCM.541(+)

GGGAUCCUAUUCCAAUCGAA

GATCCTATTCCAATCGAA

NO

gcml gRNA4

Sp.GCM.944(-)

GGGAGUCCAGCCGUCCAUCU

GAGTCCAGCCGTCCATCT

Yes

nanos2l gRNA1

Sp nanos2.190

GGUGACUGGCUCGUCGAGAC

TGACTGGCTCGTCGAGAC

Yes

nanos2l gRNA2

Sp nanos2.250

GGGAUCUCAGCGAUGUUCAG

GATCTCAGCGATGTTCAG

NO

nanos2l gRNA3

Sp nanos2.295

GGAGGAAGGCGAGCCAACAA

GGAGGAAGGCGAGCCAACAA

Yes

nanos2l gRNA4

Sp nanos2.319

GGAGGUGGUGCUACGGGUGU

GAGGTGGTGCTACGGGTGT

Yes

dll gRNA1

Delta-1 (19D10)

GGGUGAACUGGUAGCACGG

GGGTGAACTGGTAGCACGG

Yes

dll gRNA2

Delta-2 (20D11)

GGCUACACGUGCCUCUGUCC

GGCTACACGTGCCTCTGTCC

Yes

dll gRNA3

Delta-3 (20D14)

GGACCGAAUCAGAUUCCGCG

GGACCGAATCAGATTCCGCG

nd

alx1 gRNA1

Alx1-sgRNA1

GGAGAACAGGCGCGCCAAGUGG

AGAACAGGCGCGCCAAGTG

Yes

alx1 gRNA2

Alx1-sgRNA2

GGCGUGGGGGGCCUCAACCCGG

GCGTGGGGGGCCTCAACCCGG

Yes

LOC584189 gRNA1

Dsh-sgRNA1

GGGUAGCUUAGCCAGGCCGAUG

GGTAGCTTAGCCAGGCCGATG

Yes

LOC584189 gRNA2

Dsh-sgRNA2

GGCAUCGGUCCCCCUAGCCAGG

GGCATCGGTCCCCCTAGCCAGG

Yes

LOC588806 gRNA4

Pks-sgRNA1

GGGGAGGUUCUCAAGGAAGGUA

GGGAGGTTCTCAAGGAAGGTA

Yes

LOC588806 gRNA5

Pks-sgRNA2

GGGGGUUCUUUAAGAUCUCGCC

GTTCTTTAAGATCTCGCC

Yes

LOC588806 gRNA6

Pks-sgRNA3

GGGGUGGUGUCUUUGUCGGUAU

GTGGTGTCTTTGTCGGTAT

Yes

LOC588806 gRNA7

Pks-sgRNA4

GGGGGUAUUGCGCACAGUGUGU

GGTATTGCGCACAGTGTGT

Yes

LOC588806 gRNA8

Pks-sgRNA5

GGGGCGACACAGCUUGUGCCAG

CGACACAGCTTGTGCCAG

Yes

LOC588806 gRNA9

Pks-sgRNA6

GGGGUUGUCCUCAAACCCCUCA

TTGTCCTCAAACCCCTCA

Yes

LOC588806 gRNA10

Pks-sgRNA7

GGGGUAGCGCCAUCGCAGCCAA

GGTAGCGCCATCGCAGCCAA

Yes

LOC588806 gRNA11

Pks-sgRNA8

GGGGGCACUAUGUCGAAGCUCA

GCACTATGTCGAAGCTC

Yes

LOC588806 gRNA12

Pks-sgRNA9

GGGGGUGAUCCUCUGGAAGCAG

GGTGATCCTCTGGAAGCAG

Yes

LOC588806 gRNA13

Pks-sgRNA10

GGGGCACCAAAGACAACCCUCUC

GCACCAAAGACAACCCTCTC

Yes

LOC588806 gRNA14

Pks-sgRNA11

GGGGGCAACUUUGGACAUACCG

GCAACTTTGGACATACCG

Yes

LOC588806 gRNA15

Pks-sgRNA12

GGGGUACCAUCCCACCAACCAU

GTACCATCCCACCAACCAT

Yes

LOC588806 gRNA16

Pks-sgRNA13

GGGGAAGACAAGCACAUCAUUG

GAAGACAAGCACATCATTG

Yes

LOC588806 gRNA17

Pks-sgRNA14

GGGGAGGAGCUGACUCCAGAAC

AGGAGCTGACTCCAGAAC

Yes

LOC588806 gRNA18

Pks-sgRNA15

GGGGACAAGGAAGGACAGCCUA

GACAAGGAAGGACAGCCTA

Yes

LOC588806 gRNA19

Pks-sgRNA16

GGGGGACAGCUGUUGCCAAACAG

GACAGCTGTTGCCAAACAG

Yes


Table of sgRNA sequences for Temnopleurus reevesii

This table shows the gene specific spacer RNA sequence that is 5' to the constant scaffold RNA sequence. The gRNA binds to the reverse complement of the DNA sequence indicated (other strand).

Name Synonym sgRNA sequence 5-3' DNA sequence Edits Yes/NO References

TBD

Pks1#1sgRNA

GGGGUCGAUGUGAGGGUUUG

GGGGTCGATGTGAGGGTTTG

Yes

TBD

Pks1#2sgRNA

GGACAGGUACUCGUCAUGC

GGACAGGTACTCGTCATGC

Yes

TBD

Pks1#3sgRNA

GGGAUCAACCCUGAUACCCU

GGGATCAACCCTGATACCCT

NO

TBD

Pks1#4sgRNA

GGUUAACUAUGAGGCCUUUG

GGTTAACTATGAGGCCTTTG

Yes

TBD

Pks1#5sgRNA

GGUCUGAUCGAUGACCUGGA

GGTCTGATCGATGACCTGGA

Yes


Table of sgRNA sequences for Hemicentrotus pulcherrimus

This table shows the gene specific spacer RNA sequence that is 5' to the constant scaffold RNA sequence. The gRNA binds to the reverse complement of the DNA sequence indicated (other strand).

Name Synonym sgRNA sequence 5-3' DNA sequence Edits Yes/NO References

TBD

HpPks1 sgRNA#1

GUGGUGUCUUUGUCGGUAU

GTGGTGTCTTTGTCGGTAT

NO

TBD

sgRNA#2

ACUGAGGGGUUUGAGGACAA

ACTGAGGGGTTTGAGGACAA

Yes

TBD

sgRNA#3

UGAGAGGGUUGUCACGUGUG

TGAGAGGGTTGTCACGTGTG

Yes

TBD

HpPKS 82-105

GGAGCAAUAAAACCAGCUGG

GGAGCAATAAAACCAGCTGG

Pool Yes

TBD

HpPKS 101-123

GGGGAACUCGCCAUGCUUG

GGGGAACTCGCCATGCTTG

Pool Yes