Genes Not Annotated in the Current Assemblies: Difference between revisions
Created page with "'''''S. purpuratus''''' '''''L. variegatus''''' '''''P. miniata''''' '''''A. planci'''''" |
No edit summary |
||
| Line 1: | Line 1: | ||
'''''S. purpuratus''''' | '''''S. purpuratus''''' | ||
''cox17'' | |||
This gene has been characterized in the lab of Kate Buckley by Nick Kraieski. | |||
The ''cox17'' protein sequence was identified using BLAST of the human COX17 protein sequence against Echinoderm protein which returned a hit to ''P. miniata'' LOC119744863/XP_038076971.1 with the description cytochrome c oxidase copper chaperone-like. | |||
The ''P. miniata'' protein sequence, XP_038076971.1, was then BLASTed against ''S. purpuratus'' with a hit to scaffold 21, NW_022145607.1. | |||
The ''H. sapiens'' protein sequence, AAF82569.1, hit 2 regions of scaffold 21, NW_022145607.1. | |||
A hypothetical ORF was constructed from this location information, and then PCR amplified it from cDNA. | |||
ORF:ATGCCTGATAAGAAAGAAATTGAAGGTTCCGTGAATGGAGAGGGGGATGCAAAGCCCAAGTTGAAGCCGTGTTGTGCTTGTCCAGAAACGAAGAAAGTTCGAGATGCATG|CATAATGGAGAATGGAGAAGCAGAGTGTGGTGACCTTATTGAAGCGCATAAAGAATGCATGAGGTCTCTGGGGTTCAACATCTGA | |||
*The exon junction is marked with "|" (TG|C to code for a cysteine residue). | |||
Gene Location: The ORF is located in the minus strand of scaffold 21 (in 5.0 version) | |||
Coding region of Exon 1: 25740048-25739939 | |||
Coding region of Exon 2: 25735568-25735484 | |||
'''''L. variegatus''''' | '''''L. variegatus''''' | ||
Revision as of 10:04, 5 April 2024
S. purpuratus
cox17 This gene has been characterized in the lab of Kate Buckley by Nick Kraieski. The cox17 protein sequence was identified using BLAST of the human COX17 protein sequence against Echinoderm protein which returned a hit to P. miniata LOC119744863/XP_038076971.1 with the description cytochrome c oxidase copper chaperone-like. The P. miniata protein sequence, XP_038076971.1, was then BLASTed against S. purpuratus with a hit to scaffold 21, NW_022145607.1. The H. sapiens protein sequence, AAF82569.1, hit 2 regions of scaffold 21, NW_022145607.1. A hypothetical ORF was constructed from this location information, and then PCR amplified it from cDNA.
ORF:ATGCCTGATAAGAAAGAAATTGAAGGTTCCGTGAATGGAGAGGGGGATGCAAAGCCCAAGTTGAAGCCGTGTTGTGCTTGTCCAGAAACGAAGAAAGTTCGAGATGCATG|CATAATGGAGAATGGAGAAGCAGAGTGTGGTGACCTTATTGAAGCGCATAAAGAATGCATGAGGTCTCTGGGGTTCAACATCTGA
- The exon junction is marked with "|" (TG|C to code for a cysteine residue).
Gene Location: The ORF is located in the minus strand of scaffold 21 (in 5.0 version)
Coding region of Exon 1: 25740048-25739939 Coding region of Exon 2: 25735568-25735484
L. variegatus
P. miniata
A. planci